-
THE GENETIC SEQUENCE BINARY FACTOR GROUPING ROUTINES
The relation between the time of creation and the time of the life of the creation is nothing
but the borderline between the human truth about the creation
and the nature of the creation ...
The Genetic sequence binary factor grouping is a set of routines that computes V3 CEL scan data producing catalogue(s) of genetic sequence data , for the purpose of genetic analysis , generating large catalogues of genetic sequence families of curves .
(above partial display of groups of curves extracted from lung cancer datasets - lung normal )
Above :
(1) permutations count - single permutation group ,
(2) 4 cell line scans (19 scans) , single permutation group
(3) scan file values merit factor curve , single permutation group permutations chart , single permutation chart
Genes were referenced by scan measured values number serie merits ( M.J.E. Golay (1902-1989) from The Merit Factor Problem by Jedwab at http://www.math.sfu.ca/~jed/Research/merit.html ) .
Chart from CL2002042639AACEL_merits_x32x16x8x4x2x1_b16d_41.ods column A contains number scale , sorted column B contains numbers merits as computed from CL2002042639AA.CEL .
Merit factor values were computed with b16d_41.cpp from CL2002042639AA.CEL .
Binary factor grouping merits : (example bellow computed by principia routine binary_factor_number_merit_scale_routine.cpp) and permutation chart from CL2001032255AA.CEL
* Upper charts computed by binary_factor_number_merit_scale_routine_1.cpp
Binary factor grouping merits computed with binary_factor_number_merit_scale_routine_b1.cpp (upper charts top to bottom) :
(1) text file example (computer log)
(2) wav file (voice recording)
(3) single probe scan .CEL file
(4) merit values chart
(5) scan CEL file mean column values chart
Number permutations grouping generated chart using num_c_perm_2_cel.cpp from CL2001032612AA.CEL
(1) Resulting table (sorted) coumns A and B and (yellow) frequency line
(2) Peak frequency group list and real (intensity) values chart
(3) Intensity values and linearity chart
(4) Comparison of charts from lung cancer
Bellow : Lung normal results (7 rows) and their intensity values from 17 probes :
()Title : Lung norm chart in lung_norm_20120423_.ods
2152 atggcagggggtaagggggcgaaacagattttccctactttttat M A G G K G A K Q I F P T F Y 2197 ttagcaaacctctctttcgctgctgttatgtgccaggtactgggc L A N L S F A A V M C Q V L G 2242 tgctgggggatcccaagtgagcagagtctgttttctaccctcgag C W G I P S E Q S L F S T L E 2287 gagctcagagaaaaggaaatagataattactgtgtgatgagactc E L R E K E I D N Y C V M R L 2332 cagacagaggcccggcccgggcccctcgggagcagaacaacctta Q T E A R P G P L G S R T T L 2377 gtgaggtggacaggaggggacctcgcgagcagacgcgcgccagcg V R W T G G D L A S R R A P A 2422 acagcagccccgccccggcctctcgggagccgtggggcagaggct T A A P P R P L G S R G A E A 2467 gcggagccccagaaggaagcctggagagttgatgacctgatagag A E P Q K E A W R V D D L I E 2512 agaatccaagaaaacgaagacaaacattcaaggcaagctgcttgt R I Q E N E D K H S R Q A A C 2557 atcaatagcaaaaccctgactgaagagaaagagaatacatttagt I N S K T L T E E K E N T F S 2602 caaatttacatggaaacaagccttgttccttcaagcataatagct Q I Y M E T S L V P S S I I A 2647 cataattgtgtctcatgtggaaagaatttagaatctatttcgcaa H N C V S C G K N L E S I S Q 2692 ttaattagtagtgatggaagctatgctaggacaaaacctgatgag L I S S D G S Y A R T K P D E 2737 tgtaatgaatgtgggaaaacatatcatggagagaaaatgtgtgaa C N E C G K T Y H G E K M C E 2782 tttaatcaaaatggggatacctattctcacaatgaagaaaatatt F N Q N G D T Y S H N E E N I 2827 cttcagaaaattagtattttggagaaaccctttgaatataatgaa L Q K I S I L E K P F E Y N E 2872 tgcatggaagccttagacaatgaggctgtttttattgctcataag C M E A L D N E A V F I A H K 2917 agagcttacataggggagaagccctatgagtggaatgattctgga R A Y I G E K P Y E W N D S G 2962 ccagacttcatacagatgtcaaattttaatgcatatcagagatca P D F I Q M S N F N A Y Q R S 3007 caaatggaaatgaagccctttgaatgcagtgaatgtggaaaatcc Q M E M K P F E C S E C G K S 3052 ttctgtaaaaagtcaaaattcatcatccaccagagggctcacaca F C K K S K F I I H Q R A H T 3097 ggagagaaaccttatgaatgtaatgtatgtgggaaatccttcagc G E K P Y E C N V C G K S F S 3142 caaaagggaaccctcactgtacatcggagatcacacttagaggag Q K G T L T V H R R S H L E E 3187 aagccctataaatgtaatgaatgtgggaaaaccttttgtcagaag K P Y K C N E C G K T F C Q K 3232 ttacacctcactcaacacctaagaactcattcaggagagaaaccc L H L T Q H L R T H S G E K P 3277 tacgaatgtagcgaatgtgggaaaaccttctgccaaaagacacat Y E C S E C G K T F C Q K T H 3322 ctcaccctgcaccagaggaatcattcaggagagaggccctatcca L T L H Q R N H S G E R P Y P 3367 tgtaacgaatgtgggaaatccttctcccgcaagtctgctctcagt C N E C G K S F S R K S A L S 3412 gaccatcagagaactcacacgggagagaagctttataaatgtaat D H Q R T H T G E K L Y K C N 3457 gaatgtgggaaatcctactaccgaaagtctactctgattacacat E C G K S Y Y R K S T L I T H 3502 cagagaacacacacgggagagaagccctatcagtgtagcgagtgt Q R T H T G E K P Y Q C S E C 3547 gggaaattcttttctcgggtgtcatacctcactatacattataga G K F F S R V S Y L T I H Y R 3592 agtcatttagaagagaaaccctatgaatgtaatgaatgtggcaaa S H L E E K P Y E C N E C G K 3637 accttcaatttaaattcagccttcattagacatcggaaagtacac T F N L N S A F I R H R K V H 3682 acagaagagaaatcccatgaatgtagtgaatgtggaaagttctct T E E K S H E C S E C G K F S 3727 cagttgtatctcaccgaccatcatacagctcatttagaagagaaa Q L Y L T D H H T A H L E E K 3772 ccctatgaatgtaatgaatgtgggaaaaccttccttgtaaattca P Y E C N E C G K T F L V N S 3817 gccttcgatgggcaccagccacttccaaaaggggagaaatcctat A F D G H Q P L P K G E K S Y 3862 gaatgtaatgtatgtggaaagttattcaatgagttgtcatactat E C N V C G K L F N E L S Y Y 3907 actgaacattatagaagtcattcagaagagaaaccttatggatgt T E H Y R S H S E E K P Y G C 3952 agcgaatgtgggaaaaccttttcccataattcatccctcttcaga S E C G K T F S H N S S L F R 3997 catcaaagagtacacacaggcgagaaaccctatgaatgttacgaa H Q R V H T G E K P Y E C Y E 4042 tgtggaaaattcttctctcagaaatcatatctcactatacatcat C G K F F S Q K S Y L T I H H 4087 cgaattcattcaggagagaaaccctatgaatgtagtaaatgtgga R I H S G E K P Y E C S K C G 4132 aaagtcttctctcggatgtcaaacctcactgtccactacagaagc K V F S R M S N L T V H Y R S 4177 cattcaggagagaaaccctatgaatgtaatgaatgtgggaaagtc H S G E K P Y E C N E C G K V 4222 ttttctcagaagtcatacctcactgtacactatagaactcattca F S Q K S Y L T V H Y R T H S 4267 ggagagaaaccctatgaatgtaacgagtgtgggaaaaaattccac G E K P Y E C N E C G K K F H 4312 cacagatcagccttcaatagccatcagagaattcatagaagagga H R S A F N S H Q R I H R R G 4357 aatatgaacgtacttgatgtggaaaatctctga 4389 N M N V L D V E N L *
NP_066986.1 RB-associated KRAB zinc finger protein [Homo sapiens]
>ref|NP_001191385.1| RB-associated KRAB zinc finger protein [Homo sapiens]
>sp|Q9NYW8.1|RBAK_HUMAN RecName: Full=RB-associated KRAB zinc finger protein; AltName: Full=RB-associated KRAB repressor; Short=hRBaK; AltName: Full=Zinc finger protein 769
>gb|AAF43389.1|AF226869_1 RB-associated KRAB repressor [Homo sapiens]
>gb|AAQ93364.1| unknown [Homo sapiens] >gb|EAW87321.1| hCG1647537, isoform CRA_c [Homo sapiens]
>dbj|BAG10711.1| RB-associated KRAB repressor [synthetic construct]
>gb|AAI36677.1| RB-associated KRAB zinc finger [Homo sapiens]
>gb|AAI36676.1| RB-associated KRAB zinc finger [Homo sapiens]
BAF85758.1 unnamed protein product [Homo sapiens]
XP_001139205.1 PREDICTED: RB-associated KRAB zinc finger protein isoform 2 [Pan troglodytes]
XP_002817707.1 PREDICTED: RB-associated KRAB zinc finger protein-like [Pongo abelii]
XP_003277961.1 PREDICTED: RB-associated KRAB zinc finger protein [Nomascus leucogenys]
3619 atggccgtggcgcctctgcggggggcgctgctgctgtggcagctg M A V A P L R G A L L L W Q L 3664 ctggcggcgggcggcgcggcactggagatcggccgcttcgacccg L A A G G A A L E I G R F D P 3709 gagcgcgggcgcggggctgcgccgtgccaggcggtggagatcccc E R G R G A A P C Q A V E I P 3754 atgtgccgcggcatcggctacaacctgacccgcatgcccaacctg M C R G I G Y N L T R M P N L 3799 ctgggccacacgtcgcagggcgaggcggctgccgagctagcggag L G H T S Q G E A A A E L A E 3844 ttcgcgccgctggtgcagtacggctgccacagccacctgcgcttc F A P L V Q Y G C H S H L R F 3889 ttcctgtgctcgctctacgcgcccatgtgcaccgaccaggtctcg F L C S L Y A P M C T D Q V S 3934 acgcccattcccgcctgccggcccatgtgcgagcaggcgcgcctg T P I P A C R P M C E Q A R L 3979 cgctgcgcgcccatcatggagcagttcaacttcggctggccggac R C A P I M E Q F N F G W P D 4024 tcgctcgactgcgcccggctgcccacgcgcaacgacccgcacgcg S L D C A R L P T R N D P H A 4069 ctgtgcatggaggcgcccgagaacgccacggccggccccgcggag L C M E A P E N A T A G P A E 4114 ccccacaagggcctgggcatgctgcccgtggcgccgcggcccgcg P H K G L G M L P V A P R P A 4159 cgccctcccggagacctgggcccgggcgcgggcggcagtggcacc R P P G D L G P G A G G S G T 4204 tgcgagaaccccgagaagttccagtacgtggagaagagccgctcg C E N P E K F Q Y V E K S R S 4249 tgcgcaccgcgctgcgggcccggcgtcgaggtgttctggtcccgg C A P R C G P G V E V F W S R 4294 cgcgacaaggacttcgcgctggtctggatggccgtgtggtcggcg R D K D F A L V W M A V W S A 4339 ctgtgcttcttctccaccgccttcactgtgctcaccttcttgctg L C F F S T A F T V L T F L L 4384 gagccccaccgcttccagtaccccgagcgccccatcatcttcctc E P H R F Q Y P E R P I I F L 4429 tccatgtgctacaacgtctactcgctggccttcctgatccgtgcg S M C Y N V Y S L A F L I R A 4474 gtggccggagcgcagagcgtggcctgtgaccaggaggcgggcgcg V A G A Q S V A C D Q E A G A 4519 ctctacgtgatccaggagggcctggagaacacgggctgcacgctg L Y V I Q E G L E N T G C T L 4564 gtcttcctactgctctactacttcggcatggccagctcgctctgg V F L L L Y Y F G M A S S L W 4609 tgggtggtcctgacgctcacctggttcctggctgccgggaagaaa W V V L T L T W F L A A G K K 4654 tggggccacgaggccatcgaggcccacggcagctatttccacatg W G H E A I E A H G S Y F H M 4699 gctgcctggggcctgcccgcgctcaagaccatcgtcatcctgacc A A W G L P A L K T I V I L T 4744 ctgcgcaaggtggcgggtgatgagctgactgggctttgctacgtg L R K V A G D E L T G L C Y V 4789 gccagcacggatgcagcagcgctcacgggcttcgtgctggtgccc A S T D A A A L T G F V L V P 4834 ctctctggctacctggtgctgggcagtagtttcctcctgaccggc L S G Y L V L G S S F L L T G 4879 ttcgtggccctcttccacatccgcaagatcatgaagacgggcggc F V A L F H I R K I M K T G G 4924 accaacacagagaagctggagaagctcatggtcaagatcggggtc T N T E K L E K L M V K I G V 4969 ttctccatcctctacacggtgcccgccacctgcgtcatcgtttgc F S I L Y T V P A T C V I V C 5014 tatgtctacgaacgcctcaacatggacttctggcgccttcgggcc Y V Y E R L N M D F W R L R A 5059 acagagcagccatgcgcagcggccgcggggcccggaggccggagg T E Q P C A A A A G P G G R R 5104 gactgctcgctgccagggggctcggtgcccaccgtggcggtcttc D C S L P G G S V P T V A V F 5149 atgctcaaaattttcatgtcactggtggtggggatcaccagcggc M L K I F M S L V V G I T S G 5194 gtctgggtgtggagctccaagactttccagacctggcagagcctg V W V W S S K T F Q T W Q S L 5239 tgctaccgcaagatagcagctggccgggcccgggccaaggcctgc C Y R K I A A G R A R A K A C 5284 cgcgcccccgggagctacggacgtggcacgcactgccactataag R A P G S Y G R G T H C H Y K 5329 gctcccaccgtggtcttgcacatgactaagacggacccctctttg A P T V V L H M T K T D P S L 5374 gagaaccccacacacctctag 5394 E N P T H L *
NP_003499.1 frizzled-9 precursor [Homo sapiens]
>ref|XP_527779.3| PREDICTED: frizzled-9 [Pan troglodytes]
>sp|O00144.1|FZD9_HUMAN RecName: Full=Frizzled-9; Short=Fz-9; Short=hFz9; AltName: Full=FzE6; AltName: CD_antigen=CD349; Flags: Precursor
>gb|AAC51174.1| frizzled homolog [Homo sapiens]
>gb|AAQ93359.1| unknown [Homo sapiens]
>gb|EAW69682.1| frizzled homolog 9 (Drosophila) [Homo sapiens]
AAX29870.1 frizzled-like 9 [synthetic construct]
AAH26333.1 Frizzled homolog 9 (Drosophila) [Homo sapiens]
>gb|ABM84300.1| frizzled homolog 9 (Drosophila) [synthetic construct]
>gb|ABM87695.1| frizzled homolog 9 (Drosophila) [synthetic construct]
XP_002817910.1 PREDICTED: frizzled-9-like [Pongo abelii]
145 atgacacggagctgcggtactcgtcccagtacgaggagcgcctgg M T R S C G T R P S T R S A W 190 accccttctcctccttcagcaagcagaccccttccaggcctgctg T P S P P S A S R P L P G L L 235 agccccctgcacctctttcaggaagcctcccagagcccccgcgcc S P L H L F Q E A S Q S P R A 280 gtgccctcagcaccaggggtcaggctacaaatgccccgcaaagcc V P S A P G V R L Q M P R K A 325 cagcgggactgtttcctcagccccactggtctctgccctaaagca Q R D C F L S P T G L C P K A 370 ggcgagttctggagccaggcagccgcaggtggctgcgatgggacg G E F W S Q A A A G G C D G T 415 gaagccatgaatggtgccggccctggccccgccgcagccgccccg E A M N G A G P G P A A A A P 460 gtcccagtcccggtcccggtcccggactggcggcagttctgcgag V P V P V P V P D W R Q F C E 505 ctgcatgcgcaggcggccgccgtggactttgcgcacaagttctgc L H A Q A A A V D F A H K F C 550 cgtttcctgcgggacaacccagcttacgacacgcccgacgccggc R F L R D N P A Y D T P D A G 595 gcctccttctcccgccacttcgccgccaacttcctggacgtcttc A S F S R H F A A N F L D V F 640 ggcgaggaggtgcgccgcgtgctggtggctgggccgacgactcgg G E E V R R V L V A G P T T R 685 ggcgcggccgtgagcgcagaggccatggagccggagctcgcggac G A A V S A E A M E P E L A D 730 acctctgcactcaaggcggcgccctacggccactcgcggagctcg T S A L K A A P Y G H S R S S 775 gaggacgtgtccacgcacgcggccaccaaggcccgcgttcgcaag E D V S T H A A T K A R V R K 820 ggcttctcgctgcgcaacatgagcctgtgcgtggtggacggcgtg G F S L R N M S L C V V D G V 865 cgcgacatgtggcaccggcgcgcctcgcccgagcccgacgcggca R D M W H R R A S P E P D A A 910 gctgccccgcgcaccgccgagccccgcgacaagtggacgcggcgc A A P R T A E P R D K W T R R 955 ctgaggctgtcgcggacgctggctgccaaggtggagctggtggac L R L S R T L A A K V E L V D 1000 attcaacgcgagggggcgctgcgcttcatggtggccgacgacgcg I Q R E G A L R F M V A D D A 1045 gccgcgggctccgggggctcggctcagtggcagaagtgccgcctg A A G S G G S A Q W Q K C R L 1090 ctcctgcgcagggctgtggccgaggaacgcttccgcctggagttc L L R R A V A E E R F R L E F 1135 ttcgtgccgcaggtagagaatggagccgaatacatcttggagacc F V P Q V E N G A E Y I L E T 1180 atcgactctctgcagaagcactcgtgggtagctgacatccagggc I D S L Q K H S W V A D I Q G 1225 tgcgtggaccatgattatcaccaagccaaacatcatcatggagtg C V D H D Y H Q A K H H H G V 1270 gaggtgaaggaagtggagcagggagaggagccgtggataatggaa E V K E V E Q G E E P W I M E 1315 ggtgaatttccatgtcaacatagtcaggacaaagcagttccaatt G E F P C Q H S Q D K A V P I 1360 ccagagaaaatgagtgaatgggcacctcgacctcccccagaattt P E K M S E W A P R P P P E F 1405 gtccgagatgtcatggaaggagggagggggccgcgctcggcgccc V R D V M E G G R G P R S A P 1450 cggccgggccactgggccacaggccacgcggccacgcagtccgag R P G H W A T G H A A T Q S E 1495 cgggagccgagccgggcggggcgagggcagctccggtag 1533 R E P S R A G R G Q L R *
NP_066189.3 SH2B adapter protein 2 [Homo sapiens]
>gb|EAW50232.1| adaptor protein with pleckstrin homology and src homology 2 domains, isoform CRA_a [Homo sapiens]
XP_001144206.2 PREDICTED: SH2B adapter protein 2 [Pan troglodytes]
O14492.2 RecName: Full=SH2B adapter protein 2; AltName: Full=Adapter protein with pleckstrin homology and Src homology 2 domains; AltName: Full=SH2 and PH domain-containing adapter protein APS
XP_001108503.2 PREDICTED: SH2B adapter protein 2-like [Macaca mulatta]
BAA22514.1 APS [Homo sapiens]
137 atgctgtcccgaccgaagccatggagcaagctgacgcagaaaggc M L S R P K P W S K L T Q K G 182 cgagaacccttcatccggatgcagctctggctgaacggcgagcta R E P F I R M Q L W L N G E L 227 ggccagggtgttctacccgtccagggccagcagcaagggccaggt G Q G V L P V Q G Q Q Q G P G 272 gaaagcactccaaagacctccgccagctgcagccctgcccctgag E S T P K T S A S C S P A P E 317 tccccgatgagttccagtgagtcggtgaagagcctgaccgagctg S P M S S S E S V K S L T E L 362 gtccagcagccctgtccccccatcgaggcgagcaaggacagcaag V Q Q P C P P I E A S K D S K 407 ccaccagagcccagtgacccgccagcatccgactcccagcccaca P P E P S D P P A S D S Q P T 452 accccgctgcctctctccggacactcggccctcagcatccaagaa T P L P L S G H S A L S I Q E 497 ttagtagccatgtccccggagctggacacctacggcataaccaag L V A M S P E L D T Y G I T K 542 cgggtgaaggaggtgctgacggacaacaacctcggaggccagcgc R V K E V L T D N N L G G Q R 587 ttatttggggagaccatcttagggctcacccaaggctctgtctct L F G E T I L G L T Q G S V S 632 gacctccttgcccgccccaaaccctggcataagctcagtctgaaa D L L A R P K P W H K L S L K 677 ggacgagagcccttcgtccggatgcagctgtggctgaacgacccc G R E P F V R M Q L W L N D P 722 aacaatgtggagaagctgatggacatgaaacggatggagaagaaa N N V E K L M D M K R M E K K 767 ggacgctgtgcagagctgcaagtccgtatcactgaggctgtggcc G R C A E L Q V R I T E A V A 812 acagccactgagcagagagagctgatcgcccgcctggagcaggac T A T E Q R E L I A R L E Q D 857 ctgagcatcattcagtccatccagcggcccgatgccgggccaggt L S I I Q S I Q R P D A G P G 902 gctctacaagctggcatggagcgagagcatggagagggactgtgc A L Q A G M E R E H G E G L C 947 caccttctgcgcagccggggagctccccggagcccccgattgccg H L L R S R G A P R S P R L P 992 ggaggatcgtggagggtgcccaagaggccggcgcctttaagaagg G G S W R V P K R P A P L R R 1037 ggcgggttcgtgccctccattcaggcccttgggcctcggccattg G G F V P S I Q A L G P R P L 1082 atgaacctgcgggctgcgcgggccggaaccgcgccagcccagcgg M N L R A A R A G T A P A Q R 1127 gctaggcctccaggcccaaggtcagcatcccactgtcagccatca A R P P G P R S A S H C Q P S 1172 ttgaggtccgcaccaccatgcccctggaaatgccagagaaggata L R S A P P C P W K C Q R R I 1217 acacattcgtcctcaagccgctgtgaaggtgaacctcacttagtg T H S S S S R C E G E P H L V 1262 gaattttcgagctggcagggtcccagacacctcatgtcacaaatc E F S S W Q G P R H L M S Q I 1307 gggagagaaaccttcccaccctctgagggtctgcacgggatccca G R E T F P P S E G L H G I P 1352 ggaggagcccagcccctcaaggaagagccgggccccacgccccct G G A Q P L K E E P G P T P P 1397 gccgcgcccgcgtccccggcctgctggagcgactcgcccggccag A A P A S P A C W S D S P G Q 1442 cactacttctccagcctcgccgcggccgcctgcccgcctgcctcg H Y F S S L A A A A C P P A S 1487 ccctccgacgccgccggcgcctcctcgtcttccgcctcgtcgtcc P S D A A G A S S S S A S S S 1532 tctgccgcgtcggggcccgcccccccgcgccccgtcgagggccag S A A S G P A P P R P V E G Q 1577 ctcagcgcgcggagccgcagcaacagcgccgagcgcctgctggag L S A R S R S N S A E R L L E 1622 gccgtggccgccaccgccgccgaggagcccccggaggccgcgccc A V A A T A A E E P P E A A P 1667 ggccgcgcgcgcgccgtggagaaccagtactccttctactag 1708 G R A R A V E N Q Y S F Y *
EFB13258.1 hypothetical protein PANDA_015425 [Ailuropoda melanoleuca]
NP_853530.2 protein CASP isoform a [Homo sapiens]
>sp|P39880.3|CUX1_HUMAN RecName: Full=Homeobox protein cut-like 1; AltName: Full=CCAAT displacement protein; Short=CDP; AltName: Full=Homeobox protein cux-1
EHH52060.1 hypothetical protein EGM_12428, partial [Macaca fascicularis]
NP_001189472.1 protein CASP isoform d [Homo sapiens]
>gb|AAH66592.1| CUX1 protein [Homo sapiens]
>gb|EAW50228.1| cut-like 1, CCAAT displacement protein (Drosophila), isoform CRA_b [Homo sapiens]
21 atgagatcctgcgggaggcctatgctctgtgtcactgtctcccgg M R S C G R P M L C V T V S R 66 tgctcagcacagacaagttcaagacagatttttatgatgcgcatt C S A Q T S S R Q I F M M R I 111 ggcttgacggaagagttttgtgtggggaagtcagagctgaagggt G L T E E F C V G K S E L K G 156 cagagtcagaccatggcaacactgaaaggcctagtgcagaagggg Q S Q T M A T L K G L V Q K G 201 gtgaaggtggatctggggatccctctggagctttgggatgagccc V K V D L G I P L E L W D E P 246 agcgtggaggtcacatacctcaagaagcgcccgtccctccctgcc S V E V T Y L K K R P S L P A 291 aggagcagcctcatgcggaccgagccgctgtgcggggcatcccct R S S L M R T E P L C G A S P 336 ctgctggtgcccggcgacccctactctgtggtggttctgctgcag L L V P G D P Y S V V V L L Q 381 ggctacgcggagccagagggtgtgggcgatgccgtgcgcgccgac G Y A E P E G V G D A V R A D 426 ggctccgtgaccctggtcctaccccagacccggggcccggcctcc G S V T L V L P Q T R G P A S 471 agccaccgagagtccccgcgcgggagtggcggcgcagaggccgcc S H R E S P R G S G G A E A A 516 ctggaggaggcggcccgtggccccatcctggtggacaccgggggc L E E A A R G P I L V D T G G 561 ccctgggctcgggaggcgctgctgggggcgctggcggggcagggc P W A R E A L L G A L A G Q G 606 gtggccccgggagacgtgacgctagtggtggggacccacgggcac V A P G D V T L V V G T H G H 651 tcggatcacatcgggaacttggggctgttcccaggcgcggctctg S D H I G N L G L F P G A A L 696 ctggtctcgcacgacttctgccttcccggaggccgctacctgccc L V S H D F C L P G G R Y L P 741 cacgggctgggtgaggggcagcccctgcgcctgggcccggggctc H G L G E G Q P L R L G P G L 786 gaggtgtgggccacgccgggccacgggggccagcgcgacgtgagc E V W A T P G H G G Q R D V S 831 gtggtggtggccggcacggctctgggcaccgtggtggtggcggga V V V A G T A L G T V V V A G 876 gatgtgtttgagcgagatggggacgaggattcgtggcaggcactg D V F E R D G D E D S W Q A L 921 agtgaagaccccgcagcccaggagcggagccggaagagggtcctg S E D P A A Q E R S R K R V L 966 gtcgttgccgacgtggtcgtacctggtcacgggcccccctttcga V V A D V V V P G H G P P F R 1011 gtgttaagggaagcctcgcagcccgagacggagggtggagggaac V L R E A S Q P E T E G G G N 1056 agccagcaggagccggtggtcggagacgaggagcccgccctgcac S Q Q E P V V G D E E P A L H 1101 taa 1103 *
NP_981942.1 metallo-beta-lactamase domain-containing protein 1 [Homo sapiens]
>sp|A4D2B0.1|MBLC1_HUMAN RecName: Full=Metallo-beta-lactamase domain-containing protein 1
>gb|EAL23849.1| similar to hypothetical protein MGC49416 [Homo sapiens]
>gb|EAW76587.1| similar to hypothetical protein MGC49416 [Homo sapiens]
XP_519250.1 PREDICTED: metallo-beta-lactamase domain-containing protein 1-like [Pan troglodytes]
XP_003278139.1 PREDICTED: metallo-beta-lactamase domain-containing protein 1-like [Nomascus leucogenys]
XP_002744051.1 PREDICTED: metallo-beta-lactamase domain-containing protein 1-like [Callithrix jacchus]
AAH31288.1 Similar to hypothetical protein MGC49416 [Homo sapiens]
7 atggtttccatgatcatggacagagagtacagtgtggcagtggag M V S M I M D R E Y S V A V E 52 gccgtcagattactgatacttatccttaaacttttctaccctgag A V R L L I L I L K L F Y P E 97 tgcgagataagaacgatgggtggaagagagcaacgccagagccca C E I R T M G G R E Q R Q S P 142 ggcgcccagaggactttcttccagcttctgctgtccttctttgtg G A Q R T F F Q L L L S F F V 187 gagagcaaggtgacatacacagagagaact 216 E S K V T Y T E R T
BAH13970.1 unnamed protein product [Homo sapiens]
P0CL83.1 RecName: Full=STAG3-like protein 1; AltName: Full=Stromal antigen 3-like protein 1
>gb|AAI46457.1| Stromal antigen 3-like 1 [synthetic construct]
>gb|AAI53080.1| Stromal antigen 3-like 1 [synthetic construct]
>dbj|BAG73766.1| stromal antigen 3-like 1 [synthetic construct]
Example procedure for a single CEL file (CL2001031609AA.CEL from lung cancer (small cels)):
execute mSearch4_103 -s5. -fCL2001031609AA.CEL
search CEL file using decimal point search string eg 5. - 15.
execute num_c_perm_2_cel CL2001031609AA.CEL d > d_CL2001031609AA.txt
execute num_c_perm_2_cel CL2001031609AA.CEL c > c_CL2001031609AA.txt
produce matching columns table from these two files , having perm codes and values in each row using eg scalc and paste its conents into eg a.txt
execute mSearch4_103 -s555 -fa.txt > b.txt
extract lines and values rows having perm code 555
extract values onlu columns from b.txt using eg scalc
produce one values column replacing \t by \n
sort values list
produce unique sorted list n.txt
execute ts_ce_53 using n.txt and Lung_DATASETA_scans_noscale.res
out.txt will have all single or multiple range values matches in _.res file
And the region image of the corresponding aminoacid :
Full=Hepatitis A virus cellular receptor 2; Short=HAVcr-2; AltName: Full=T-cell immunoglobulin and mucin domain-containing protein 3; Short=TIMD-3;
AltName: Full=T-cell membrane protein 3; AltName: Full=TIM-3;
101 atggcgtcttctatcagaaggggccgaggggcctggacacggctg M A S S I R R G R G A W T R L 146 ctctcgcttctgctcctcgcagcctgggaggtggggagcggccag L S L L L L A A W E V G S G Q 191 ctccgctactccgtccccgaggaggccaaacacggcaccttcgtg L R Y S V P E E A K H G T F V 236 ggccgcatcgcgcaggacctggggctggagctggaggagctggtg G R I A Q D L G L E L E E L V 281 ccgcgcctgttccgggtggcgtccaaaagacacggggaccttctg P R L F R V A S K R H G D L L 326 gaggtaaatctgcagaatggcattttgtttgtgaattctcggatc E V N L Q N G I L F V N S R I 371 gaccgggaggagctgtgcgggcggagcgcggaatgtagcatccac D R E E L C G R S A E C S I H 416 gtggaggtgatcgtggacaggccgctgcaggttttccatgtggaa V E V I V D R P L Q V F H V E 461 gtggaggtgaaggacattaacgacaacccgccaatatttccaatg V E V K D I N D N P P I F P M 506 acagtaaagactatccggtttcccgaatcaaggctgcttgattct T V K T I R F P E S R L L D S 551 cggtttcctctagagggagcatctgatgcagatataggagtaaat R F P L E G A S D A D I G V N 596 gctcttctctcctacaagctcagctccagtgagtttttcttccta A L L S Y K L S S S E F F F L 641 gatatacaggcaaatgatgaactaagcgaatctttgtctctcgtg D I Q A N D E L S E S L S L V 686 ctggggaaatcgctggacagagaggaaactgctgaggttaatttg L G K S L D R E E T A E V N L 731 ttactggtggctactgatgggggcaaacctgagctcacgggcacc L L V A T D G G K P E L T G T 776 gttcaaatacttattaaggtattagatgtaaatgacaatgaacca V Q I L I K V L D V N D N E P 821 acttttgcccaatcagtttacaaagtaaaattgttagagaatacg T F A Q S V Y K V K L L E N T 866 gcaaatgggaccttagtggttaagttaaacgcttctgatgcagat A N G T L V V K L N A S D A D 911 gaaggaccgaacagcgagattgtgtattcactcggtagtgatgtg E G P N S E I V Y S L G S D V 956 tcctccactatacagactaagtttaccatagatcccatctcaggg S S T I Q T K F T I D P I S G 1001 gaaatcagaactaagggaaaattagattatgaagaagcaaagtcc E I R T K G K L D Y E E A K S 1046 tacgagattcaggtcactgcaactgacaaaggaaccccttcaatg Y E I Q V T A T D K G T P S M 1091 tcaggacattgtaaaatttcattaaaacttgtggacatcaatgat S G H C K I S L K L V D I N D 1136 aacacaccagaagtctcaataacgtctctctcacttcccatctca N T P E V S I T S L S L P I S 1181 gagaacgcttccctgggcactgtcattgctctcatcacggtgtcg E N A S L G T V I A L I T V S 1226 gatcgcgactctggtacgaatggacatgtcacctgctccctgacg D R D S G T N G H V T C S L T 1271 ccccacgtccctttcaagctggtgtccaccttcaagaattactac P H V P F K L V S T F K N Y Y 1316 tcgttggtgctggacagcgccctggaccgcgagagcgtgtcagcc S L V L D S A L D R E S V S A 1361 tatgagctggtggtgaccgcacgggacgggggctcgccttcactg Y E L V V T A R D G G S P S L 1406 tgggccaccaccagcgtgtccatcgaggtggccgacgtgaacgac W A T T S V S I E V A D V N D 1451 aacgcgccggcgttcgcacagcctgagtacacagtattcgtgaag N A P A F A Q P E Y T V F V K 1496 gagaacaacccgccgggctgccacatcttcacggtgtcagcgtgg E N N P P G C H I F T V S A W 1541 gatgcggacgcgcaggagaacgcgctggtgtcctactcgctggtg D A D A Q E N A L V S Y S L V 1586 gagcggcgggtgggcgagcgcgcgttgtcgagctacgtttcggtg E R R V G E R A L S S Y V S V 1631 cacgcggagagcggcaaggtgtacgcgctgcagccgctggaccac H A E S G K V Y A L Q P L D H 1676 gaggaagtggagctgctgcagttccaggtgagcgcgcgggatgcg E E V E L L Q F Q V S A R D A 1721 ggcgtgccgcctctgggcagcaacgtgacgctgcaggtgttcgtg G V P P L G S N V T L Q V F V 1766 ctggacgagaacgacaacgcgccggcactgttggcgcctagggct L D E N D N A P A L L A P R A 1811 ggcaccgctgctggcgcagtgagtgagctggtgccgtggtcggtg G T A A G A V S E L V P W S V 1856 ggtgcagggcacgtggtggcgaaggtgcgcgcagtggacgctgac G A G H V V A K V R A V D A D 1901 tcaggctacaacgcgtggctttcgtacgagcttcagctgggtact S G Y N A W L S Y E L Q L G T 1946 ggcagcgctcgcatcccgttccgcgtggggctatacacgggtgag G S A R I P F R V G L Y T G E 1991 atcagcacgacacgtgccctagacgaggctgactcccctcgacac I S T T R A L D E A D S P R H 2036 cgcctactcgtgctggtgaaggaccacggcgaaccagcgttgaca R L L V L V K D H G E P A L T 2081 gccacggccaccgtgttagtgtcgttggtggaaagtggccaggca A T A T V L V S L V E S G Q A 2126 cccaaggcctcgtcgcgggcgtgggtgggcgccgcgggctcagag P K A S S R A W V G A A G S E 2171 gctacgctggtggatgtcaacgtgtacctgatcatcgccatctgc A T L V D V N V Y L I I A I C 2216 gcggtatccagcctgttggtgctcacggtgctgctgtacactgcg A V S S L L V L T V L L Y T A 2261 ctgcggtgctcggtgccacccaccgagggtgcgcgcgcgccagga L R C S V P P T E G A R A P G 2306 aagcccacgctggtgtgctccagcgccgtggggagctggtcttac K P T L V C S S A V G S W S Y 2351 tcgcagcagaggcggcagagggtgtgctctggggaggaccccccc S Q Q R R Q R V C S G E D P P 2396 aagacggacctcatggccttcagccctagcttatctcaaggtcca K T D L M A F S P S L S Q G P 2441 gactccgcagaagagaaacagctctcagaatcagaatacgtagga D S A E E K Q L S E S E Y V G 2486 aaggtgagtcttaaatatggaggatgcagctgcacttga 2524 K V S L K Y G G C S C T *
NP_113683.1 protocadherin alpha-2 isoform 2 precursor [Homo sapiens]
>gb|AAD43741.1|AF152480_1 protocadherin alpha 2 short form protein [Homo sapiens]
>gb|AAC34324.1| KIAA0345-like 12 [Homo sapiens]
EAW61999.1 hCG1982192, isoform CRA_n [Homo sapiens]
AAH03126.1 Protocadherin alpha 2 [Homo sapiens]
NP_061728.1 protocadherin alpha-2 isoform 1 precursor [Homo sapiens]
>sp|Q9Y5H9.1|PCDA2_HUMAN RecName: Full=Protocadherin alpha-2; Short=PCDH-alpha-2; Flags: Precursor
>gb|AAD43704.1| protocadherin alpha 2 [Homo sapiens]
EAW61993.1 hCG1982192, isoform CRA_h [Homo sapiens]
155 atgagaaatttacatgatcctatagcacactttagggaaacttat M R N L H D P I A H F R E T Y 200 gcaacttgccagttcactttgtttgcagtagtcaaagccctggag A T C Q F T L F A V V K A L E 245 acatcagcatttaactgtgatttgaaattgctgaagtgggccgtt T S A F N C D L K L L K W A V 290 ccactaggctgcatggcctacacagcaagtctaataacagacggc P L G C M A Y T A S L I T D G 335 cctgtttggggggaaatgaccagtctgcagattggctacccaact P V W G E M T S L Q I G Y P T 380 gttgcatcagtaccccattctatcatcaacgggtacaaacgagtc V A S V P H S I I N G Y K R V 425 ctggccttgtctgtggagacggattacaccttcccactcgctgaa L A L S V E T D Y T F P L A E 470 aaggtcaaggccttcttggctgatccatctgcctttgtggctgct K V K A F L A D P S A F V A A 515 gcccctgtggctgctgccaccacagctgctcctgctgctgctgca A P V A A A T T A A P A A A A 560 gccccagctaaggttgaagccaaggaagagtcggaggagtcggac A P A K V E A K E E S E E S D 605 gaggatatgggatttggtctctatggagagatgaaggagcttgca E D M G F G L Y G E M K E L A 650 ggtttgaagtgcagagaagaatgctggctccaaggagaaagaaga G L K C R E E C W L Q G E R R 695 gaggagagctcttcaactagctgcttaaatctccgttgcccctcg E E S S S T S C L N L R C P S 740 gggcacctcgatgccacattaaaggcacatccatcattggacaga G H L D A T L K A H P S L D R 785 tctgcagtggaggcaggcgctggggcatttagtgaactggcctgc S A V E A G A G A F S E L A C 830 caggttctgttttctgctgtagcctctgagagcgtgcgtcatcat Q V L F S A V A S E S V R H H 875 tgtcacctaattccactttatgctaatcaggacagatcatgggaa C H L I P L Y A N Q D R S W E 920 ggcttaattgggaatgacatgaagccattcattctactgcagtgg G L I G N D M K P F I L L Q W 965 aaaactaaactatgctatagtcgaatatacgggttggggatgggg K T K L C Y S R I Y G L G M G 1010 ggtggggtggaatcttggctggcaggaaaggacacaggcctttta G G V E S W L A G K D T G L L 1055 atctcagaaccaaaaatactctgcgctctgatttctccaacttca I S E P K I L C A L I S P T S 1100 tttcactatgaagggcattctgctcctccaagtcggtgtgacata F H Y E G H S A P P S R C D I 1145 tcacagggcactcgcgagtgcttctggaagccctgccgcggaggt S Q G T R E C F W K P C R G G 1190 cgactcttttaccagagacagaaggtcgggaagatgcagcgagta R L F Y Q R Q K V G K M Q R V 1235 cagcgttcttattataactcgcctcctcacaggtttctgggcaga Q R S Y Y N S P P H R F L G R 1280 gcactaacctgccctaacctgttacctggaataatggatgtaaag A L T C P N L L P G I M D V K 1325 gaccggcgacaccgctctttgaccagaggacgctgtggcaaagag D R R H R S L T R G R C G K E 1370 tgtcgctacacaagctcctctctggacagtgaggactgccgcgtg C R Y T S S S L D S E D C R V 1415 cccacacagaaatcctacagctccagtgagactctgaaggcctat P T Q K S Y S S S E T L K A Y 1460 gaccatgacagcaggatgcactatggaaaccgagtcacagacctc D H D S R M H Y G N R V T D L 1505 atccaccgggagtcagatgagtttcccaccctaggaaccaacttc I H R E S D E F P T L G T N F 1550 acccttgccgaactgggcatctgtgagccctccccacaccgaagc T L A E L G I C E P S P H R S 1595 ggctactgctccgacatggggatccttcaccagggctactccctt G Y C S D M G I L H Q G Y S L 1640 agcacagggtctgacgccgactccgacaccgagggagggatgtct S T G S D A D S D T E G G M S 1685 ccagaacacgccatcagactgtggggcagagggataaaatccagg P E H A I R L W G R G I K S R 1730 cgcagttccggcctgtccagtcgtgaaaactcggcccttaccctg R S S G L S S R E N S A L T L 1775 actgactctgacaacgaaaacaaatcagatgatgcctattatgct T D S D N E N K S D D A Y Y A 1820 tttccttcccagctggagaaggcctcagctgtgtcagactgggac F P S Q L E K A S A V S D W D 1865 tgctggtga 1873 C W *
CCD17866.1 odz, odd Oz/ten-m homolog 2 (Drosophila) [Homo sapiens]
CCD17867.1 odz, odd Oz/ten-m homolog 2 (Drosophila) [Homo sapiens]
XP_003582533.1 PREDICTED: teneurin-2 isoform 6 [Bos taurus]
NP_001116151.1 teneurin-2 [Homo sapiens]
XP_003268681.1 PREDICTED: teneurin-2 isoform 3 [Nomascus leucogenys]
XP_003582531.1 PREDICTED: teneurin-2 isoform 4 [Bos taurus]
Q9NT68.3 RecName: Full=Teneurin-2; Short=Ten-2; AltName: Full=Protein Odd Oz/ten-m homolog 2; AltName: Full=Tenascin-M2; Short=Ten-m2
2501 atggagttttcctggggaagcggccaggaatcccggcgtctgctg M E F S W G S G Q E S R R L L 2546 ctcttacttcttctcctcgcagcctgggaggcagggaacggtcag L L L L L L A A W E A G N G Q 2591 ctccactactcggtctccgaggaggccaaacacggcaccttcgtg L H Y S V S E E A K H G T F V 2636 ggccgcatcgcgcaggacctgggactggagctggcggagctggtg G R I A Q D L G L E L A E L V 2681 ccgcgcctgttccgggtggcgtccaagggccgcggaggccttctg P R L F R V A S K G R G G L L 2726 gaggtaaatctgcagaatggcattttgtttgtgaattctcggatc E V N L Q N G I L F V N S R I 2771 gaccgggaggagctgtgccggcggagcgcggagtgcagcatccac D R E E L C R R S A E C S I H 2816 ctggaggtgatcgtagacaggccgctgcaggttttccatgtggac L E V I V D R P L Q V F H V D 2861 gtggaggtgagggacattaacgataacccgccggtgttcccagca V E V R D I N D N P P V F P A 2906 acacaaaagaacctgtccatcgcggaatccaggccgcttgactct T Q K N L S I A E S R P L D S 2951 cggtttccactagagggcgcctcggatgcagatatcggggagaac R F P L E G A S D A D I G E N 2996 gccctgctcacttacagactgagcccaaatgaatacttttctctg A L L T Y R L S P N E Y F S L 3041 gaaaaaccacctgatgacgagctggtaaaaggtcttgggcttata E K P P D D E L V K G L G L I 3086 ttacggaaatctttagacagagaagaagctccggagattttttta L R K S L D R E E A P E I F L 3131 gtgctcacagccactgatggaggcaaacccgagttgactggcacc V L T A T D G G K P E L T G T 3176 gttcagttactcatcacagtactggatgccaatgacaatgcccca V Q L L I T V L D A N D N A P 3221 gcttttgacagaaccatttataaggtgagattactagaaaatgtt A F D R T I Y K V R L L E N V 3266 cctaatggaacattggtaattaaacttaacgcctcagatttagac P N G T L V I K L N A S D L D 3311 gaaggattgaatggggacattgtttattcattctcaaatgatatt E G L N G D I V Y S F S N D I 3356 tcgccaaatgtgaaatccaagtttcacatagatccaattactgga S P N V K S K F H I D P I T G 3401 caaattattgtaaagggatatattgactttgaagaaagcaaatcc Q I I V K G Y I D F E E S K S 3446 tatgaaattattgtagagggcattgataagggacagctcccactt Y E I I V E G I D K G Q L P L 3491 tctggccattgtagagttattgtggaagtagaagacaacaacgat S G H C R V I V E V E D N N D 3536 aatgtcccagatttggaattcaagtctttatcacttccaattaga N V P D L E F K S L S L P I R 3581 gaggacgctccactgggtacagtcatcgccctgatcagcgtgtcc E D A P L G T V I A L I S V S 3626 gacaaagacatgggtgtcaatgggctggtcacctgctccttgacg D K D M G V N G L V T C S L T 3671 tcccacgtccccttcaagctggtgtccaccttcaagaattactac S H V P F K L V S T F K N Y Y 3716 tcgttggtgctggacagtgccctggaccgcgagagcgtgtcagcc S L V L D S A L D R E S V S A 3761 tatgagctggtggtgaccgcgcgagacgggggctcgccttcgctg Y E L V V T A R D G G S P S L 3806 tgggccacggccagtgtttctgtggaggtggctgatgtgaacgac W A T A S V S V E V A D V N D 3851 aacgctccggcgttcgcgcagcccgagtacacagtgttcgtgaag N A P A F A Q P E Y T V F V K 3896 gagaacaacccgccgggctgccacatcttcactgtgtctgcgtgg E N N P P G C H I F T V S A W 3941 gacgcggacgcgcaggagaacgcgctggtgtcctactcgctggta D A D A Q E N A L V S Y S L V 3986 gagcggcgggtaggggagcgcgcgctgtcgagctacgtttcggtg E R R V G E R A L S S Y V S V 4031 catgcggagagcggcaaggtgtacgcgctgcagccgctggaccac H A E S G K V Y A L Q P L D H 4076 gaggagctagagctgctgcagtttcaggtgaccgctcgcgatgcc E E L E L L Q F Q V T A R D A 4121 ggcgtgccacctctgggcagcaacgtgacgctgcaggtgttcgtg G V P P L G S N V T L Q V F V 4166 ctggacgaaaacgacaacgcgccagcactgctagcgcctcgggcg L D E N D N A P A L L A P R A 4211 ggtggcactggtggcgcagtgagcgagctggtgccatggtcggtg G G T G G A V S E L V P W S V 4256 ggtgtgggccacgtggtggcaaaggtgcgcgcggtggatgctgac G V G H V V A K V R A V D A D 4301 tcgggctacaacgcgtggctttcgtacgagctgcagccggggact S G Y N A W L S Y E L Q P G T 4346 ggtggcgcgcgcatcccgttccgcgtggggctgtacactggcgag G G A R I P F R V G L Y T G E 4391 atcagcacaacgcgtgccctggacgaaacggacgctccgcgccac I S T T R A L D E T D A P R H 4436 cgcctactggtactggtgaaggaccacggcgagcccgcgctgacg R L L V L V K D H G E P A L T 4481 gccacggccactgtgctggtgtcacttgtggagagtggacaggcg A T A T V L V S L V E S G Q A 4526 ccaaaggcctcctcacgggcgttggtgggcgctgtgggtcccgat P K A S S R A L V G A V G P D 4571 gctgcgctggtggatgtcaacgtatacctgatcattgccatctgc A A L V D V N V Y L I I A I C 4616 gcggtgtccagccttttggtgctcacgctgctgctgtacaccgcg A V S S L L V L T L L L Y T A 4661 ctgcggtgctctgcgctgcccaccgagggcgcgtgcgctccgggc L R C S A L P T E G A C A P G 4706 aagcccacgctggtgtgctccagtgcggtggggagctggtcatac K P T L V C S S A V G S W S Y 4751 tcgcagcagaggaggccgagggtgtgctctggtgagggcccaccc S Q Q R R P R V C S G E G P P 4796 aagaccgacctcatggccttcagccccagtttacctgactctagg K T D L M A F S P S L P D S R 4841 gacagagaagatcagctgcagacaactgaggaatcctttgcaaag D R E D Q L Q T T E E S F A K 4886 gtggaaataaaaccagaggtatttgacatggtgtttaccccggag V E I K P E V F D M V F T P E 4931 gatagattgggaaagcaatgtctgctcctcccgcttctgctcctc D R L G K Q C L L L P L L L L 4976 gcagcctggaaggtggggagcggccagctccactactccgtaccc A A W K V G S G Q L H Y S V P 5021 gaggaggccaaacacggcaccttcgtgggccggatcgcgcaggac E E A K H G T F V G R I A Q D 5066 ctggggctggagctggcggagctggtgccgcgcctgttcaggatg L G L E L A E L V P R L F R M 5111 gcctccaaagaccgcgaggaccttctggaggtaaatctgcagaat A S K D R E D L L E V N L Q N 5156 ggcattttgtttgtgaattctcggatcgaccgcgaggagctgtgc G I L F V N S R I D R E E L C 5201 gggcggagcgcggagtgcagcatccacctggaggtgatcgtggac G R S A E C S I H L E V I V D 5246 aggccgctgcaggttttccatgtggacgtggaggtgagggacatt R P L Q V F H V D V E V R D I 5291 aacgacaacccgcccttgttcccggtagaggaacaaagagtgctg N D N P P L F P V E E Q R V L 5336 atttacgaatctaggctgccagattctgtgtttccactggagggc I Y E S R L P D S V F P L E G 5381 gcgtccgatgcagatgttggctcaaattccatcttaacctataaa A S D A D V G S N S I L T Y K 5426 ctcagttctagcgaatacttcgggctagatgtgaaaataaacagt L S S S E Y F G L D V K I N S 5471 gatgacaataaacaaattgggctcttattaaagaaatccttggac D D N K Q I G L L L K K S L D 5516 agagaggaagctcctgcacacaacttattcctgacagccacagat R E E A P A H N L F L T A T D 5561 gggggcaaacctgagctcacaggcactgttcagctgctggtcaca G G K P E L T G T V Q L L V T 5606 gtgctggatgtgaatgataatgctcccactttcgaacagtctgaa V L D V N D N A P T F E Q S E 5651 tacgaagtaagaatattcgaaaatgcagacaacggaacaacagtt Y E V R I F E N A D N G T T V 5696 atcagactgaatgcttctgatcgggatgaaggagcgaatggggca I R L N A S D R D E G A N G A 5741 atttcatattcttttaatagccttgttgcagccatggttattgac I S Y S F N S L V A A M V I D 5786 cactttagcatagatcgaaatacgggagaaatagtgattcggggt H F S I D R N T G E I V I R G 5831 aatttggattttgaacaagaaaacttatacaaaatcctcattgac N L D F E Q E N L Y K I L I D 5876 gccacggacaaaggccatcctcccatggcgggtcattgcaccgtt A T D K G H P P M A G H C T V 5921 ttagtgagaattttggataaaaatgataacgtccctgagatagca L V R I L D K N D N V P E I A 5966 ctgacttccttatccttgcctgtacgtgaagacgctcaatttggt L T S L S L P V R E D A Q F G 6011 actgtcatcgccctaattagcgtgaacgacctcgattcaggtgcc T V I A L I S V N D L D S G A 6056 aacgggcaggtgaactgctcgctgacgcctcacgtccctttcaag N G Q V N C S L T P H V P F K 6101 ctggtgtccaccttcaagaattactactcgttggtgctggacagt L V S T F K N Y Y S L V L D S 6146 gccctggaccgcgagagcgtgtcggcctatgagttggtggtaacc A L D R E S V S A Y E L V V T 6191 gcgcgggacgggggctcgccttcgctgtgggccaccgccagcttg A R D G G S P S L W A T A S L 6236 tctgtggaggtggccgacatgaatgacaatgctccggcgttcgcg S V E V A D M N D N A P A F A 6281 cagcccgagtacacagtgttcgtgaaggagaacaacccgccgggc Q P E Y T V F V K E N N P P G 6326 tgccacatcttcacggtgtctgcgcgagacgcggacgcgcaggag C H I F T V S A R D A D A Q E 6371 aacgcgctggtgtcctactcgctggtggagcggcgggtgggcgag N A L V S Y S L V E R R V G E 6416 cgcgcgttgtcgagctacatttcggtgcacgcggagagcggcaag R A L S S Y I S V H A E S G K 6461 gtgtacgcgctgcagccgctggaccacgaggagctagagctgctg V Y A L Q P L D H E E L E L L 6506 cagtttcaggtgagcgcgcgcgacgcgggcgtgccgcctctgggc Q F Q V S A R D A G V P P L G 6551 agcaacgtgacgctgcaggtgttcgtgctggacgagaacgacaac S N V T L Q V F V L D E N D N 6596 gcgccggcgctgctggcgcctcgggtgggtggtactggtggtgca A P A L L A P R V G G T G G A 6641 gtgagcgagctggtgccgcggtcactgggtgcaggccaagtggtg V S E L V P R S L G A G Q V V 6686 gcgaaggtgcgcgcagttgacgccgactcaggctacaacgcgtgg A K V R A V D A D S G Y N A W 6731 ctttcgtatgagctgcagcccccggcaagcagcgctcgcttcccg L S Y E L Q P P A S S A R F P 6776 tttcgcgtggggctgtacacgggcgagatcagcaccactcgtgtc F R V G L Y T G E I S T T R V 6821 ctggacgaagcggactctccgcgccaccggctgctggtgctggtg L D E A D S P R H R L L V L V 6866 aaagaccacggtgagccggcgctgacagcgacggccacggttctg K D H G E P A L T A T A T V L 6911 gtgtcgctggtggagagtggccaggctccaaaggcgtcatcacgg V S L V E S G Q A P K A S S R 6956 gcgtcggtgggcgccgcgggcccagaggcggcgctggtggatgtc A S V G A A G P E A A L V D V 7001 aacgtgtacctgatcatcgccatctgcgcggtatccagcctgctg N V Y L I I A I C A V S S L L 7046 gtcctcacgctactgctgtacacagcgctgcggtgctcggcgcca V L T L L L Y T A L R C S A P 7091 cccaccgagggcgcgtgcacggcggacaagcccacgctggtgtgc P T E G A C T A D K P T L V C 7136 tccagcgcagtggggagctggtcgtactcgcagcagaggcggcag S S A V G S W S Y S Q Q R R Q 7181 agggtgtgctccggggagggcccacccaagatggatctcatggcc R V C S G E G P P K M D L M A 7226 tttagccccagcctttcaccttgtcctattatgatgggtaaggcg F S P S L S P C P I M M G K A 7271 gagaatcaggatttaaatgaagatcatgatgccaaagtggtgtgc E N Q D L N E D H D A K V V C 7316 ccgaatggatacgacccagggggccgacatctactgctgtttatt P N G Y D P G G R H L L L F I 7361 ataattctagcagcttgggaggcagggagaggccagctccactac I I L A A W E A G R G Q L H Y 7406 tcggtccccgaggaggctaaacatggcaacttcgtgggccgcatc S V P E E A K H G N F V G R I 7451 gcgcaggacctggggctggagctggcggagctggtgccgcgcctg A Q D L G L E L A E L V P R L 7496 ttccgggcggtgtgcaaattccgtggggatcttctggaggtaaat F R A V C K F R G D L L E V N 7541 ctgcagaatggcattttgtttgtgaattctcggatcgaccgcgag L Q N G I L F V N S R I D R E 7586 gagctgtgcgggcggagcgcggagtgcagcatccacctggaggtg E L C G R S A E C S I H L E V 7631 atcgtggaaaggccgctgcaggttttccatgtggacgtggaggtg I V E R P L Q V F H V D V E V 7676 aaggacattaacgacaaccctccggtgttcccagcgacacaaagg K D I N D N P P V F P A T Q R 7721 aatctgttcatcgcggaatccaggccgcttgactctcggtttcca N L F I A E S R P L D S R F P 7766 ctagagggcgcgtccgatgcagatatcggggagaacgccctgctc L E G A S D A D I G E N A L L 7811 acttacagactgagccccaatgagtatttcttcctggacgtgcca T Y R L S P N E Y F F L D V P 7856 accagcaaccagcaggtaaaacctcttggacttgtattacggaaa T S N Q Q V K P L G L V L R K 7901 cttttagacagagaagaaactccggagcttcatttattgctcacg L L D R E E T P E L H L L L T 7946 gccaccgatggaggcaaacccgagctgactggcaccgttcaatta A T D G G K P E L T G T V Q L 7991 ctcatcacggtactggacaacaatgacaatgccccagtgttcgac L I T V L D N N D N A P V F D 8036 agaaccctgtatacggtgaaattaccagaaaacgtttctatcgga R T L Y T V K L P E N V S I G 8081 acgctggtgattcaccccaatgcctcagatttagacgaaggcttg T L V I H P N A S D L D E G L 8126 aatggggatattatttactccttctccagtgatgtttctccagat N G D I I Y S F S S D V S P D 8171 ataaaatccaagttccacatggaccccttaagtggggcaatcaca I K S K F H M D P L S G A I T 8216 gtgataggacatatggattttgaagaaagtagagcacacaagatc V I G H M D F E E S R A H K I 8261 ccagtcgaggctgtcgataaaggcttcccacccctggctggtcat P V E A V D K G F P P L A G H 8306 tgtacagttcttgtggaagttgtggatgtaaatgacaatgctcca C T V L V E V V D V N D N A P 8351 cagttgactctcacttccctgtctctccctattccagaggacgcc Q L T L T S L S L P I P E D A 8396 caaccaggtaccgtcatcacattgattagcgtgtttgaccgagat Q P G T V I T L I S V F D R D 8441 tttggagtcaacggacaggttacctgctccctgacgccccgcgtt F G V N G Q V T C S L T P R V 8486 cccttcaagttggtgtccaccttcaagaattactattcattggtg P F K L V S T F K N Y Y S L V 8531 ctggacagcgctctggaccgcgagagtgtgtccgcctatgagctg L D S A L D R E S V S A Y E L 8576 gtggttaccgcgcgggacgggggctcgccttctctgtgggccact V V T A R D G G S P S L W A T 8621 gctagcgtgtccgtggaggtggccgacgtgaacgacaacgccccg A S V S V E V A D V N D N A P 8666 gcgttcgcgcagcccgagtatacggtgttcgtgaaggagaacaac A F A Q P E Y T V F V K E N N 8711 ccgccgggctgccacatcttcactgtgtcggcgggggacgcggac P P G C H I F T V S A G D A D 8756 gcgcagaagaacgcgctggtgtcctactcgctggtggagctgcgg A Q K N A L V S Y S L V E L R 8801 gtgggcgagcgcgcgctgtcgagctacgtgtcagtgcacgcggag V G E R A L S S Y V S V H A E 8846 agcggcaaggtgtacgcgctgcagccgttggaccacgaggagctg S G K V Y A L Q P L D H E E L 8891 gagctgttgcagttccaggtgagcgcgcgcgatgcgggcgtgccg E L L Q F Q V S A R D A G V P 8936 cctctgggcagcaacgtgacgctgcaggtgttcgtgctggacgag P L G S N V T L Q V F V L D E 8981 aacgacaacgcgccggcactgctggcgcctcgggtgggtggcact N D N A P A L L A P R V G G T 9026 ggtggcgcagtgagagagcttgtgccgcggtctgtgggcgcgggc G G A V R E L V P R S V G A G 9071 catgtggtggcgaaggtacgtgcagttgacgctgactcaggctac H V V A K V R A V D A D S G Y 9116 aacgcgtggctttcgtatgagttgcaaccggtggcggccggtgcg N A W L S Y E L Q P V A A G A 9161 agcatcccgttccgcgtggggctgtacactggtgagatcagcacg S I P F R V G L Y T G E I S T 9206 acacgagccctagatgagacggacgcaccgcgccaccgccttctg T R A L D E T D A P R H R L L 9251 gtgcttgtgaaggaccacggggagccctcgctgacagccacagcc V L V K D H G E P S L T A T A 9296 accgtgctggtgtcgctggtggaaagcggccaggcaccaaaggcg T V L V S L V E S G Q A P K A 9341 tcgtcgcgggcatcgttgggcattgcaggcccagagaccgagctg S S R A S L G I A G P E T E L 9386 gtggatgtcaacgtgtacctgatcatcgccatctgcgcggtgtcc V D V N V Y L I I A I C A V S 9431 agtctgttggtgcttaccctgctgctgtacacggcgttgcggtgc S L L V L T L L L Y T A L R C 9476 tcagcgccgtcctctgagggcgcatgtagtttggtaaagcccact S A P S S E G A C S L V K P T 9521 ctggtgtgctccagcgcggtggggagctggtcattctcccagcag L V C S S A V G S W S F S Q Q 9566 aggcggcagagggtgtgctctggggagggcccacccaagacagac R R Q R V C S G E G P P K T D 9611 ctcatggccttcagtcccagccttcctcagggtccatcctctaca L M A F S P S L P Q G P S S T 9656 gacaatgtggattatcactggcgaggagagctgggatcctggcga D N V D Y H W R G E L G S W R 9701 ctactactcttgcttctgctcctcgcagcctggaaggtggggagc L L L L L L L L A A W K V G S 9746 ggccagctccactactccgtccccgaggaggccaaacacggcacc G Q L H Y S V P E E A K H G T 9791 ttcgtgggccggatcgcgcaggacctggggctggagctggcggag F V G R I A Q D L G L E L A E 9836 ctggtgccgcgcctgttccgggtggcgtccaaaagacaccgggac L V P R L F R V A S K R H R D 9881 cttctggaggtaagtctgcagaatggcattttgtttgtgaattct L L E V S L Q N G I L F V N S 9926 cggatcgaccgcgaggagctgtgcgggcggagcgcggagtgcagc R I D R E E L C G R S A E C S 9971 atccacctggaggtgatcgtggacaggccgctgcaggttttccat I H L E V I V D R P L Q V F H 10016 gtggacgtggaggtgaaggatgttaatgacaacccgccagtgttc V D V E V K D V N D N P P V F 10061 cgggtaaaagaccaaaagctgtttgtttcagaatccagaatgcca R V K D Q K L F V S E S R M P 10106 gactctcggtttccgctagagggcgcgtccgatgcagatgttgga D S R F P L E G A S D A D V G 10151 gctaactccgtgttaacctacaggcttagctctcatgattacttc A N S V L T Y R L S S H D Y F 10196 atgctagatgtgaattcaaagaacgatgagaataaactggttgag M L D V N S K N D E N K L V E 10241 ctcgtattaagaaaatccttggacagagaggacgctcctgcgcac L V L R K S L D R E D A P A H 10286 cacttattcctgacagccacagatgggggcaaacctgagctcaca H L F L T A T D G G K P E L T 10331 ggcactgttcagctgctggtcacagtgctggatgtgaatgataat G T V Q L L V T V L D V N D N 10376 gctcccactttcgaacagtctgaatacgaagtaagaatattcgaa A P T F E Q S E Y E V R I F E 10421 aacgcagacaacggaacaacagttatcaaactgaatgcttctgat N A D N G T T V I K L N A S D 10466 ccggatgaaggagccaatggggcaatttcatattcttttaatagc P D E G A N G A I S Y S F N S 10511 cttgttgaaactatggttattgaccactttagcatagatcgaaat L V E T M V I D H F S I D R N 10556 acgggagaaatagtgattcggggtaatttggattttgaacaagaa T G E I V I R G N L D F E Q E 10601 aacttatacaaaatcctcattgacgccacggacaaaggccatcct N L Y K I L I D A T D K G H P 10646 cccatggcgggtcattgcaccgttttagtgagaattttggataaa P M A G H C T V L V R I L D K 10691 aatgataacgtccctgagatagcactgacttccttatccttgcct N D N V P E I A L T S L S L P 10736 gtacgtgaagacgctcaatttggtactgtcatcgccctaattagc V R E D A Q F G T V I A L I S 10781 gtgaacgacctcgattcaggtgccaacgggcaggtgacctgctcc V N D L D S G A N G Q V T C S 10826 ctgatgccccatgtccccttcaagctggtgtccaccttcaagaat L M P H V P F K L V S T F K N 10871 tactactcgttggtgctggacagcgccctggaccgcgagagagtg Y Y S L V L D S A L D R E R V 10916 tcggcctatgagttggtggtaaccgcgcgggacgggggctcgcct S A Y E L V V T A R D G G S P 10961 tcgctgtgggccaccgccagcttgtctgtggaggtggccgacgtg S L W A T A S L S V E V A D V 11006 aacgacaatgctccggcgttcgcgcagcccgagtacacggtgttc N D N A P A F A Q P E Y T V F 11051 gtgaaggagaacaacccgccgggctgccacatcttcacggtgtct V K E N N P P G C H I F T V S 11096 gcgcgagacgcggacgcgcaggagaacgcgctggtgtcctactcg A R D A D A Q E N A L V S Y S 11141 cttgtggagcggcgggtgggcgagcgctcgctgtcgagctacatt L V E R R V G E R S L S S Y I 11186 tcggtgcacacggagagcggcaaggtgtacgcgctgcagccgctg S V H T E S G K V Y A L Q P L 11231 gaccacgaggagctagagctgctgcagttccaggtgagcgcgcgc D H E E L E L L Q F Q V S A R 11276 gacgcgggcgtgccgcctctgggcagcaacgtgacgctgcaggtg D A G V P P L G S N V T L Q V 11321 ttcgtgctggacgagaatgacaacgcgccggcactgctggagcct F V L D E N D N A P A L L E P 11366 cgggtgggtggcactggtggcgcagcgagcaagctggtgccgcgg R V G G T G G A A S K L V P R 11411 tctgtgggcgcgggccacgtggtagcgaaggtgcgcgcagtggac S V G A G H V V A K V R A V D 11456 gccgactcgggctacaacgcgtggctttcgtatgagctgcagcca A D S G Y N A W L S Y E L Q P 11501 gctgcaagcagccctcgcatcccgttccgcgtggggctgtacacg A A S S P R I P F R V G L Y T 11546 ggcgagatcagcaccactcgtgtcctggacgaagcggactctccg G E I S T T R V L D E A D S P 11591 cgccaccgtctgctggtcctggtgaaggatcatggtgaacctgcg R H R L L V L V K D H G E P A 11636 ctgaccgccacggccacggttctggtgtcgctggtggagagcggc L T A T A T V L V S L V E S G 11681 caggctccaaaagcgtcatcgaggcagtcggctggcgttttgggt Q A P K A S S R Q S A G V L G 11726 ccggaagcggcgctggtggatgtcaacgtgtacctgatcatcgcc P E A A L V D V N V Y L I I A 11771 atctgcgcggtatccagcctgctggtgctcacgctgctgctgtac I C A V S S L L V L T L L L Y 11816 actgcgctgcggtgctcagcactgcccactgagggcgggtgccgg T A L R C S A L P T E G G C R 11861 gcgggcaagcccactctggtgtgctccagtgcggtggggagctgg A G K P T L V C S S A V G S W 11906 tcatactcgcaacaacagccgcagagggtgtgctctggtgagggg S Y S Q Q Q P Q R V C S G E G 11951 ccaccgaagacggacctcatggccttcagcccctgccttcctcct P P K T D L M A F S P C L P P 11996 gatctgggatcagttgatgtaggcgaagagcaagatttaaatgtt D L G S V D V G E E Q D L N V 12041 gatcatggcctcaaagtggtttccagatgtagctgcctgggggtc D H G L K V V S R C S C L G V 12086 cagtgtctgctgctctcgcttcttctcctcgcagcctgggaggtg Q C L L L S L L L L A A W E V 12131 gggagcggccagctccactactcagtctacgaggaggccagacac G S G Q L H Y S V Y E E A R H 12176 ggcaccttcgtgggccgcatcgcgcaggacctggggctggagctg G T F V G R I A Q D L G L E L 12221 gcggagctggtgcagcgcctgttccgggtggcgtccaaaagacac A E L V Q R L F R V A S K R H 12266 ggggaccttctggaggtaaatctgcagaatggcattttgtttgtg G D L L E V N L Q N G I L F V 12311 aattctcggattgaccgcgaggagctgtgcgggcggagcgtggag N S R I D R E E L C G R S V E 12356 tgcagcatccacctggaggtgatcgtggacaggccgctgcaggtt C S I H L E V I V D R P L Q V 12401 ttccatgtggacgtggaagtgaaggacattaacgacaacccgccc F H V D V E V K D I N D N P P 12446 aggttctccgtaacagaacaaaagctctcaatacctgaatccaga R F S V T E Q K L S I P E S R 12491 ctgcttgactctcgatttccactagaaggcgcatctgatgcggat L L D S R F P L E G A S D A D 12536 gttggagagaacgcattgcttacttacaaactcagtccaaatgag V G E N A L L T Y K L S P N E 12581 tattttgttcttgatattataaacaaaaaagacaaagacaaattc Y F V L D I I N K K D K D K F 12626 ccagtgcttgttctgcggaagctgctggatcgtgaagaaaatcct P V L V L R K L L D R E E N P 12671 cagctaaagttgttgttgacagcaactgatggaggcaaacctgaa Q L K L L L T A T D G G K P E 12716 tttaccggatctgtttctctgctgatcctggtgttagatgccaat F T G S V S L L I L V L D A N 12761 gataacgcccctatctttgacagaccggtttatgaagttaagatg D N A P I F D R P V Y E V K M 12806 tatgaaaatcaagtgaaccaaacattagtaatacggctcaacgct Y E N Q V N Q T L V I R L N A 12851 tctgattcggatgaaggaataaacaaggaaatgatgtattcattt S D S D E G I N K E M M Y S F 12896 agctctttggtcccacccacgataagaaggaaattttggataaac S S L V P P T I R R K F W I N 12941 gaaaggacgggagaaataaaagtaaatgatgctattgactttgag E R T G E I K V N D A I D F E 12986 gacagtaacacttatgaaattcatgtagatgttacagataaggga D S N T Y E I H V D V T D K G 13031 aacccacctatggttggtcactgcacggtcctagtggaactactg N P P M V G H C T V L V E L L 13076 gatgaaaatgataattcacctgaggtgattgtcacttctctgtct D E N D N S P E V I V T S L S 13121 ctcccagtgaaagaagatgctcaagtgggcaccgtcattgcccta L P V K E D A Q V G T V I A L 13166 atcagcgtttctgaccatgattcaggagccaacggacaggtcacc I S V S D H D S G A N G Q V T 13211 tgctctctgacgcctcacgttccgttcaagctggtgtccacctac C S L T P H V P F K L V S T Y 13256 aagaattactactcattggtgctggacagcgctctggaccgcgag K N Y Y S L V L D S A L D R E 13301 agggtgtcggcctatgagctggtggtgaccgcgcgggacgggggc R V S A Y E L V V T A R D G G 13346 tcgcctccgctgtgggccacggccagcgtgtctgtggaggtggcc S P P L W A T A S V S V E V A 13391 gacgtgaacgacaacgcgcctgcgttcgcgcagtccgagtacacg D V N D N A P A F A Q S E Y T 13436 gtgttcgtgaaggagaacaacccgccaggctgccacatcttcacg V F V K E N N P P G C H I F T 13481 gtgtctgcgtgggacgcggacgcgcaggagaacgccctggtgtcc V S A W D A D A Q E N A L V S 13526 tactctctggtggagcggcggttgggcgagcgctcgctgtcgagc Y S L V E R R L G E R S L S S 13571 tacgtgtcggtgcacgcggagagcggcaaggtgtacgcgctgcag Y V S V H A E S G K V Y A L Q 13616 ccgctggaccacgaggagctggagctgctacagttccaggtgagc P L D H E E L E L L Q F Q V S 13661 gcgcgcgatgggggcgtgccgcctctgggcagcaacttgacgctg A R D G G V P P L G S N L T L 13706 caggtgttcgtgctggacgagaacgacaacgctcccgcgctgctg Q V F V L D E N D N A P A L L 13751 gcgtctcccgctggcagcgcgggcggtgcagtcagtgagctggtg A S P A G S A G G A V S E L V 13796 ctgcggtcggtggttgcgggtcacgtggtggctaaggtgcgcgca L R S V V A G H V V A K V R A 13841 gtggacgctgactctggatacaacgcgtggctgtcgtatgaattg V D A D S G Y N A W L S Y E L 13886 cagtcggcggcggttggtgcacgcatcccgtttcgcgtggggctg Q S A A V G A R I P F R V G L 13931 tacacgggcgagatcagtacgacgcgcgctctggatgagactgac Y T G E I S T T R A L D E T D 13976 tcgccacgccagcgcctactggtgctggtgaaggaccatggcgag S P R Q R L L V L V K D H G E 14021 ccgtcgctgacggccacggccactgtgcttgtgtcgcttgtggag P S L T A T A T V L V S L V E 14066 ggcagccaggcacccaaggcctcgtcgcgggcttcagtgggcgtg G S Q A P K A S S R A S V G V 14111 gcgcccgaggtggccctggtggatgtcaacgtgtacctgatcatc A P E V A L V D V N V Y L I I 14156 gccatctgcgcggtgtccagcttgctggtgctcacgctgctgctg A I C A V S S L L V L T L L L 14201 tacactgcactgaggtgctcggcggcgcccaccgagggcgcatgt Y T A L R C S A A P T E G A C 14246 gggccggtgaagcccacgctggtgtgctctagcgcggtggggagc G P V K P T L V C S S A V G S 14291 tggtcttactcgcagcagaggcggcagagggtgtgttctggggag W S Y S Q Q R R Q R V C S G E 14336 ggcctgcccaaggcggacctcatggccttcagccccagccttcca G L P K A D L M A F S P S L P 14381 ccatgcccaatggtagatgtggacggggaagatcagtctattgga P C P M V D V D G E D Q S I G 14426 ggggaccactctaggaaggttagacttttcctttgtggattcttt G D H S R K V R L F L C G F F 14471 tttaaaactaccaagtttgagaatatgaatatatttgtttttcat F K T T K F E N M N I F V F H 14516 attgttctgcaatga 14530 I V L Q *
EGW01360.1 Protocadherin alpha-4 [Cricetulus griseus]
XP_848914.2 PREDICTED: protocadherin alpha-4 [Canis lupus familiaris]
NP_114062.1 protocadherin alpha-8 isoform 2 precursor [Homo sapiens]
>gb|AAD43747.1|AF152486_1 protocadherin alpha 8 short form protein [Homo sapiens]
>gb|AAC34318.1| KIAA0345-like 6 [Homo sapiens]
>gb|AAI36751.1| Protocadherin alpha 8 [Homo sapiens]
NP_114036.1 protocadherin alpha-6 isoform 2 precursor [Homo sapiens]
>gb|AAD43745.1|AF152484_1 protocadherin alpha 6 short form protein [Homo sapiens]
>gb|AAC34320.1| KIAA0345-like 8 [Homo sapiens]
NP_061734.1 protocadherin alpha-8 isoform 1 precursor [Homo sapiens]
>sp|Q9Y5H6.1|PCDA8_HUMAN RecName: Full=Protocadherin alpha-8; Short=PCDH-alpha-8; Flags: Precursor
>gb|AAD43710.1| protocadherin alpha 8 [Homo sapiens]
NP_113688.1 protocadherin alpha-4 isoform 2 precursor [Homo sapiens]
>gb|AAD43743.1|AF152482_1 protocadherin alpha 4 short form protein [Homo sapiens]
>gb|AAC34322.1| KIAA0345-like 10 [Homo sapiens]
>gb|AAI12103.1| Protocadherin alpha 4, isoform 2 precursor [Homo sapiens]
>gb|AAI13610.1| Protocadherin alpha 4 [Homo sapiens] >gb|ADR83254.1| protocadherin alpha 4 [synthetic construct]
NP_114040.1 protocadherin alpha-7 isoform 2 precursor [Homo sapiens]
>gb|AAD43746.1|AF152485_1 protocadherin alpha 7 short form protein [Homo sapiens]
>gb|AAC34319.1| KIAA0345-like 7 [Homo sapiens]
NP_061724.1 protocadherin alpha-10 isoform 1 precursor [Homo sapiens]
>sp|Q9Y5I2.1|PCDAA_HUMAN RecName: Full=Protocadherin alpha-10; Short=PCDH-alpha-10; Flags: Precursor
>gb|AAD43700.1| protocadherin alpha 10 [Homo sapiens]
910 atgctttttcctgatgagaaagaattcacaggagcacaaagtggg M L F P D E K E F T G A Q S G 955 ggaccgcagcagaatcctggggtattagatgggcctcagaaaaaa G P Q Q N P G V L D G P Q K K 1000 ccagaagggccaatacaggccatgatggcccaatcccaaagccta P E G P I Q A M M A Q S Q S L 1045 ggtaagggacctgggccccggacagacgtgggagctccatttggc G K G P G P R T D V G A P F G 1090 cctcaaggacatagagatgtacccttttctccagatgaaatggtt P Q G H R D V P F S P D E M V 1135 ccaccttctatgaactcccagtctgggaccataggacccgaccac P P S M N S Q S G T I G P D H 1180 cttgaccatatgactcccgagcagatagcgtggctgaaactgcag L D H M T P E Q I A W L K L Q 1225 caggagttttatgaagagaagaggaggaagcaggaacaagtggtt Q E F Y E E K R R K Q E Q V V 1270 gtccagcagtgttccctccaggacatgatggtccatcagcacggg V Q Q C S L Q D M M V H Q H G 1315 cctcggggagtggtccgaggacccccccctccataccagatgacc P R G V V R G P P P P Y Q M T 1360 cctagtgaaggctgggcacctgggggtacagagccattttctgat P S E G W A P G G T E P F S D 1405 ggtatcaacatgccacattctctgcccccgaggggcatggctccc G I N M P H S L P P R G M A P 1450 caccccaacatgccagggagccagatgcgcctccctggatttgca H P N M P G S Q M R L P G F A 1495 ggcatgataaactctgaaatggaagggccgaatgtccccaaccct G M I N S E M E G P N V P N P 1540 gcatctagaccaggtctttctggagtcagttggccagatgatgtg A S R P G L S G V S W P D D V 1585 ccaaaaatcccagatggtcgaaattttcctcctggccagggcatt P K I P D G R N F P P G Q G I 1630 ttcagcggtcctggccgaggggaacgcttcccaaacccccaagga F S G P G R G E R F P N P Q G 1675 ttgtctgaagagatgtttcagcagcagctggcagagaaacagctg L S E E M F Q Q Q L A E K Q L 1720 ggtctccccccagggatggccatggaaggcatcaggcccagcatg G L P P G M A M E G I R P S M 1765 gagatgaacaggatgattccaggctcccagcgccacatggagcct E M N R M I P G S Q R H M E P 1810 gggaataaccccattttccctcgaataccagttgagggccctctg G N N P I F P R I P V E G P L 1855 agtccttctaggggtgactttccaaaaggaattcccccacagatg S P S R G D F P K G I P P Q M 1900 ggccctggtcgggaacttgagtttgggatggttcctagtgggatg G P G R E L E F G M V P S G M 1945 aagggagatgtcaatctaaatgtcaacatgggatccaactctcag K G D V N L N V N M G S N S Q 1990 atgatacctcagaagatgagagaggctggggcgggccctgaggag M I P Q K M R E A G A G P E E 2035 atgctgaaattacgcccaggtggctcagacatgctgcctgctcag M L K L R P G G S D M L P A Q 2080 cagaagatggtgccactgccatttggtgagcacccccagcaggag Q K M V P L P F G E H P Q Q E 2125 tatggcatgggccccagaccattccttcccatgtctcagggtcca Y G M G P R P F L P M S Q G P 2170 ggcagcaacagtggcttgcggaatctcagagaaccaattgggccc G S N S G L R N L R E P I G P 2215 gaccagaggactaacagccggctcagtcatatgccaccactacct D Q R T N S R L S H M P P L P 2260 ctcaacccttccagtaaccccaccagcctcaacacagctcctcca L N P S S N P T S L N T A P P 2305 gttcagcgcggcctggggcggaagcccttggatatatctgtggca V Q R G L G R K P L D I S V A 2350 ggcagccaggtgcattccccaggcattaaccctctgaagtctccc G S Q V H S P G I N P L K S P 2395 acgatgcaccaagtccagtcaccaatgctgggctcgccctcgggg T M H Q V Q S P M L G S P S G 2440 aacctcaagtccccccagactccatcgcagctggcaggcatgctg N L K S P Q T P S Q L A G M L 2485 gcgggcccagctgctgctgcttccattaagtccccccctgttttg A G P A A A A S I K S P P V L 2530 gggtctgctgctgcttcacctgtccacctcaagtctccatcactt G S A A A S P V H L K S P S L 2575 cctgccccgtcacctggatggacctcttctccaaaacctcccctt P A P S P G W T S S P K P P L 2620 cagagtcctgggatccctccaaaccataaagcacccctcaccatg Q S P G I P P N H K A P L T M 2665 gcctccccagccatgctgggaaatgtagagtcgagagaaagagca A S P A M L G N V E S R E R A 2710 catatttctccgtgggacactccttgtattgacggcgtcgggctg H I S P W D T P C I D G V G L 2755 gagagccgcagtcccggctgcagcacctgggagaaggcagaccgt E S R S P G C S T W E K A D R 2800 gtgagggggcctgtggccccagcgtgctgtggcctccgggagtgg V R G P V A P A C C G L R E W 2845 gaagtggaggcaggagccttccttacacttcgccatgagtttcct E V E A G A F L T L R H E F P 2890 gatcgactccagcatcatgattacctaggcttgggtttggatact D R L Q H H D Y L G L G L D T 2935 tctccagtaatgaaggcccctcccaagctggagggtgatgctact S P V M K A P P K L E G D A T 2980 gatggctcctttgccaataagcatggctgccatgtcattggccac D G S F A N K H G C H V I G H 3025 attgatgactacagtgccctaagacagcagattgcggagggcaag I D D Y S A L R Q Q I A E G K 3070 ctgctggtcaaaaagatagtgtctcttgtgagatcagcgtgcagc L L V K K I V S L V R S A C S 3115 ttccctggccttgaagcccaaggcacagaggtaagaggagacgag F P G L E A Q G T E V R G D E 3160 tgtcagtacagcctcctctcccctagccagacgctcagggtcacc C Q Y S L L S P S Q T L R V T 3205 accttcccctctgctcgcccgtcgccattcttccaaccactcgct T F P S A R P S P F F Q P L A 3250 gccaaagattccaccaacagtcacccacaggacaacccaggcctc A K D S T N S H P Q D N P G L 3295 ctttcagcagaggctcccgccccgcagccaccgcgccctctcacc L S A E A P A P Q P P R P L T 3340 cccgcagttctgcccgccgcctctgcccagtag 3372 P A V L P A A S A Q *
BAG11026.1 B-cell lymphoma 9 protein [synthetic construct]
NP_004317.2 B-cell CLL/lymphoma 9 protein [Homo sapiens]
>sp|O00512.4|BCL9_HUMAN RecName: Full=B-cell CLL/lymphoma 9 protein; Short=B-cell lymphoma 9 protein; Short=Bcl-9; AltName: Full=Protein legless homolog
>emb|CAI15198.1| B-cell CLL/lymphoma 9 [Homo sapiens]
>gb|EAW50932.1| B-cell CLL/lymphoma 9, isoform CRA_a [Homo sapiens]
>gb|EAW50933.1| B-cell CLL/lymphoma 9, isoform CRA_a [Homo sapiens]
XP_513752.2 PREDICTED: b-cell CLL/lymphoma 9 protein [Pan troglodytes]
AAI16452.1 B-cell CLL/lymphoma 9 [Homo sapiens]
CAA73942.1 B-cell CLL/lymphoma 9 [Homo sapiens]
A single CEL file (N01_normal.CEL from prostate normal): NM_001031834 Homo sapiens RAB40A, member RAS oncogene family-like (RAB40AL), mRNA
4929 atgttctatgctaatttctcaagaagaacaggcccggcaccacct M F Y A N F S R R T G P A P P 4884 ctgcgcacaaccccgcgggcctggctcaggcgggagtgcggggcc L R T T P R A W L R R E C G A 4839 agcaccatgagcgccccgggcagccccgaccaggcctatgacttc S T M S A P G S P D Q A Y D F 4794 ctgctcaagttcctgctggtgggcgacagggacgtaggcaagagt L L K F L L V G D R D V G K S 4749 gagatcctggagagcctgcaggatggtgcagctgagtccccgtac E I L E S L Q D G A A E S P Y 4704 agccatctcggggggatcgactacaagacgaccaccatcctgctg S H L G G I D Y K T T T I L L 4659 gacggccagcgggtgaagctgaagctctgggatacgtcggggcag D G Q R V K L K L W D T S G Q 4614 ggaagattttgtaccatattccgctcctactctcgtggtgcacaa G R F C T I F R S Y S R G A Q 4569 ggagtgatcctggtctacgacattgcaaaccgctggtctttcgag G V I L V Y D I A N R W S F E 4524 ggtatggatcgatggattaagaagattgaggaacatgcccctggt G M D R W I K K I E E H A P G 4479 gtccctaaaatcctggtggggaatcgcctacatctggcattcaag V P K I L V G N R L H L A F K 4434 aggcaggtgcccagggagcaggcccaggcctacgccgagcgcctg R Q V P R E Q A Q A Y A E R L 4389 ggtgtgaccttctttgaggtcagccctctgtgcaatttcaacatc G V T F F E V S P L C N F N I 4344 atagagtctttcacggagctggccaggatagtgctgctgcggcac I E S F T E L A R I V L L R H 4299 aggatgaattggctcgggaggccgagcaaggtactgagcttgcaa R M N W L G R P S K V L S L Q 4254 gacctctgctgccgcaccatcgtgtcctgcacacctgtgcatctg D L C C R T I V S C T P V H L 4209 gtggacaagctcccgctccccagtaccttaagaagccacctcaag V D K L P L P S T L R S H L K 4164 tccttctccatggctaagggcctgaatgccaggatgatgcgaggc S F S M A K G L N A R M M R G 4119 ctctcctactccctcaccaccagctccactcacaagagcagcctc L S Y S L T T S S T H K S S L 4074 tgcaaagtggagatcgtctgcccaccccagagcccacccaaaaac C K V E I V C P P Q S P P K N 4029 tgcaccagaaacagctgcaaaatttcttaa 4000 C T R N S C K I S *
XP_001137221.2 PREDICTED: ras-related protein Rab-40A isoform 1 [Pan troglodytes]
NP_543155.2 ras-related protein Rab-40A [Homo sapiens]
>sp|Q8WXH6.2|RB40A_HUMAN RecName: Full=Ras-related protein Rab-40A; AltName: Full=SOCS box-containing protein RAR2A; Short=Protein Rar-2; Flags: Precursor
>gb|AAL75949.1|AF132748_1 Rar-2 protein [Homo sapiens]
>gb|AAH74854.1| RAB40A, member RAS oncogene family [Homo sapiens]
>gb|AAH74855.1| RAB40A, member RAS oncogene family [Homo sapiens]
>emb|CAI41993.1| RAB40A, member RAS oncogene family [Homo sapiens]
>gb|AAI17233.1| RAB40A, member RAS oncogene family [Homo sapiens]
>gb|AAI13502.1| RAB40A, member RAS oncogene family [Homo sapiens]
>dbj|BAF02899.1| Rab40A [Homo sapiens]
>gb|EAW54708.1| RAB40A, member RAS oncogene family, isoform CRA_b [Homo sapiens]
>dbj|BAG74194.1| RAB40A, member RAS oncogene family [synthetic construct]
>gb|ADR82904.1| RAB40A, member RAS oncogene family (RAB40A) [synthetic construct]
39 atgttacttcagaaccctcaactggcttatgctttgctgcaagca M L L Q N P Q L A Y A L L Q A 84 caggtagtgatgagaattgtggatccggaaattgccctggtccca Q V V M R I V D P E I A L V P 129 gtcatgcagggaacaggaatgcaaggagcaagtatacagggtgga V M Q G T G M Q G A S I Q G G 174 agccagcctggcggctttagtcccgggcagaaccaagtcactcca S Q P G G F S P G Q N Q V T P 219 caggatcatgagaagggttttcaaaaatacctggcaagaaatctg Q D H E K G F Q K Y L A R N L 264 gaaattctataa 275 E I L *
EAX02819.1 cleavage stimulation factor, 3' pre-RNA, subunit 2, 64kDa, isoform CRA_b [Homo sapiens]
BAG62297.1 unnamed protein product [Homo sapiens]
AAH33135.1 Similar to cleavage stimulation factor, 3' pre-RNA, subunit 2, 64kD, partial [Homo sapiens]
NP_001316.1 cleavage stimulation factor subunit 2 [Homo sapiens]
>ref|XP_003317595.1| PREDICTED: cleavage stimulation factor subunit 2 isoform 1 [Pan troglodytes]
>sp|P33240.1|CSTF2_HUMAN RecName: Full=Cleavage stimulation factor subunit 2; AltName: Full=CF-1 64 kDa subunit; AltName: Full=Cleavage stimulation factor 64 kDa subunit; Short=CSTF 64 kDa subunit; Short=CstF-64
>gb|AAA35724.1| cleavage stimulation factor [Homo sapiens]
>gb|AAH17712.1| Cleavage stimulation factor, 3' pre-RNA, subunit 2, 64kDa [Homo sapiens]
>gb|AAP88780.1| cleavage stimulation factor, 3' pre-RNA, subunit 2, 64kDa [Homo sapiens]
>emb|CAI42680.1| cleavage stimulation factor, 3' pre-RNA, subunit 2, 64kDa [Homo sapiens]
>emb|CAB06072.2| cleavage stimulation factor, 3' pre-RNA, subunit 2, 64kDa [Homo sapiens]
>gb|AAX41742.1| cleavage stimulation factor 3' pre-RNA subunit 2 [synthetic construct]
>gb|AAX41743.1| cleavage stimulation factor 3' pre-RNA subunit 2 [synthetic construct]
>gb|EAX02818.1| cleavage stimulation factor, 3' pre-RNA, subunit 2, 64kDa, isoform CRA_a [Homo sapiens]
>gb|ABM82458.1| cleavage stimulation factor, 3' pre-RNA, subunit 2, 64kDa [synthetic construct]
>gb|ABM85647.1| cleavage stimulation factor, 3' pre-RNA, subunit 2, 64kDa [synthetic construct]
>dbj|BAI46582.1| Cleavage stimulation factor 64 kDa subunit [synthetic construct]
* All following results computed with b16d_41.cpp
Gene annotations were queried by accession numbers by http://genecards.weizmann.ac.il/cgi-bin/geneannot/GA_search.pl
NCBI gi numbers were queried by gene annotations by http://www.ncbi.nlm.nih.gov/nuccore?term=SMAD4 using an automated PHP script url_get.txt .
Factor grouping permutation chart derived by a31_t.cpp and chart values linear crossection used for number range(s) selection .
()Title : Lung adenocarcinoma ADENO_1 chart in adeno1_res_20110224.ods
Ref: PMCID: PMC2538683 , NIHMSID: NIHMS52941:
Characterizing the cancer genome in lung adenocarcinoma Nature 450,893-898 (06 December 2007)
()Title : Lung adenocarcinoma ADENO_7 chart in adeno7_res_20110224.ods
Ref: PMCID: PMC2953495
Expression of Conjoined Genes: Another Mechanism for Gene Regulation in Eukaryotes Published online 2010 October 12. - 10.1371/journal.pone.0013284
Ref: PMCID: PMC2953495
Targeted Proteomic Analysis of 14-3-3, a p53 Effector Commonly Silenced in Cancer Published on March 18, 2005, doi: 10.1074/mcp.M500021-MCP200
Ref: PMID: 12750859
DNA sequence variation and molecular genotyping of natural killer leukocyte immunoglobulin-like receptor, LILRA3 Immunogenetics. 2003 Jun;55(3):165-71. Epub 2003 May 16.
And this is a novel gene found on 14.12.2011 in the described region :
LOC100653070 leukocyte immunoglobulin-like receptor subfamily A member 3-like [ Homo sapiens ]
Leukocyte immunoglobulin-like receptor, subfamily A (with TM domain), member 6 [Homo sapiens]
gi|341914911| 906 bp mRNA
BASE COUNT 167 a 302 c 249 g 188 t
ORIGIN
1 caggtggcat ttgatggctt cattctgtgt aaggaaggag aagatgaaca cccacaatgc 61 ctgaactccc attcccatgc ccgtgggtca tcccgggcca tcttctccgt gggccccgtg 121 agcccaagtc gcaggtggtc gtacaggtgc tatggttatg actcgcgcgc tccctatgtg 181 tggtctctac ccagtgatct cctggggctc ctggtcccag gtgtttctaa gaagccatca 241 ctctcagtgc agccgggtcc tgtcgtggcc cctggggaga agctgacctt ccagtgtggc 301 tctgatgccg gctacgacag atttgttctg tacaaggagt ggggacgtga cttcctccag 361 cgccctggcc ggcagcccca ggctgggctc tcccaggcca acttcaccct gggccctgtg 421 agccgctcct acgggggcca gtacacatgc tccggtgcat acaacctctc ctccgagtgg 481 tcggccccca gcgaccccct ggacatcctg atcacaggac agatccgtgc cagacccttc 541 ctctccgtgc ggccgggccc cacagtggcc tcaggagaga acgtgaccct gctgtgtcag 601 tcacagggag ggatgcacac tttccttttg accaaggagg gggcagctga ttccccgctg 661 cgtctaaaat caaagcgcca atctcataag taccaggctg aattccccat gagtcctgtg 721 acctcggccc acgcggggac ctacaggtgc tacggctcac tcagctccaa cccctacctg 781 ctgactcacc ccagtgaccc cctggagctc gtggtctcag gtgagggccc tgaccctgtc 841 ctctctgagc tcaaaggctc agctcaggcc ctgcccccag cagagctctg ggacaataat 901 gaatga
Where the following GTGCAGCCGGGTCCTGTCGTGGCCCCTGGGGAGAAGCTGACCTTCCAGTGTGGCTCTGATGCCGGCTACG sequence results in :
ref|XM_003403848.1| Gene info linked to XM_003403848.1
Genome view with mapviewer linked to XM_003403848.1 PREDICTED:
Homo sapiens leukocyte immunoglobulin-like receptor subfamily A member 3-like (LOC100653070), partial mRNA Length=906
GENE ID: 100653070 LOC100653070 leukocyte immunoglobulin-like receptor subfamily A member 3-like [Homo sapiens]
And :
ref|NM_001080978.2 Gene info linked to NM_001080978.2
Genome view with mapviewer linked to NM_001080978.2 Homo sapiens leukocyte immunoglobulin-like receptor, subfamily B (with TM and ITIM domains), member 2 (LILRB2), transcript variant 2, mRNA Length=2937
GENE ID: 10288 LILRB2 | leukocyte immunoglobulin-like receptor, subfamily B (with TM and ITIM domains), member 2 [Homo sapiens]
Where the bold marked sequence results in:
ref|NR_034098.1| Gene info linked to NR_034098.1
Genome view with mapviewer linked to NR_034098.1
Homo sapiens echinoderm microtubule associated protein like 2 (EML2), transcript variant 4, non-coding RNA Length=1995
GENE ID: 24139 EML2 | echinoderm microtubule associated protein like 2 [Homo sapiens]
And :
ref|NM_014971.1| Gene info linked to NM_014971.1
Genome view with mapviewer linked to NM_014971.1
Homo sapiens EFR3 homolog B (S. cerevisiae) (EFR3B), mRNA Length=7500
GENE ID: 22979 EFR3B | EFR3 homolog B (S. cerevisiae) [Homo sapiens]
()Title : Lung adenocarcinoma ADENO_1 chart in adeno1_res_20110224.ods
()Title : Lung adenocarcinoma ADENO_2 chart in adeno2_res_20110224.ods
()Title : Lung adenocarcinoma ADENO_3 chart in adeno3_res_20110224.ods
()Title : Lung adenocarcinoma ADENO_4 chart in adeno4_res_20110224.ods
()Title : Lung adenocarcinoma ADENO_5 chart in adeno5_res_20110224.ods
()Title : Lung adenocarcinoma ADENO_6 chart in adeno6_res_20110224.ods
()Title : Lung adenocarcinoma ADENO_7 chart in adeno7_res_20110224.ods
()Title : Lung adenocarcinoma ADENO_8 chart in adeno8_res_20110224.ods
()Title : Lung adenocarcinoma ADENO_9 chart in adeno9_res_20110225.ods
()Title : Lung adenocarcinoma ADENO_10 chart in adeno10_res_20110225.ods
()Title : Lung adenocarcinoma ADENO_1-10 chart in adeno_1-10_20110516.ods .
()Title : Prostate tumor Prostate Tumor Sample CEL files T01-T30 and T31-T60 chart in pc_20110517.ods .
()Title : Haining Lab : Human Naive and Memory T cell Subsets chart 90 probes in tmap_1-90_20110329.ods .
()Title : Gene expression-based chemical genomics identifies rapamycin as a modulator of MCL-1 and glucocorticoid resistance in leukemia 29 probes results chart in armstrong_part_20110721_1.ods .
()Title : Gene Expression-Based Classification and Outcome Prediction of Central Nervous System Embryonal Tumors PT_SCANS_1 chart in pt1_20110305.ods .
Blast (www.ncbi.nih.gov) searches produce long genomic regions and numerous unmapped sequences .
Analysis of fasta coded genomic regions may get easier by searches based on single sequence permutations .
Determining typical sequences in a long genimic region results in numerous SNP s .
num_c_perm_2_fasta.cpp is locating long permuting sequences in a fasta coded genomic region .
Two runs (eg: num_c_perm_2_fasta LOC100653050.txt c > a.txt and num_c_perm_2_fasta LOC100653050.txt d > b.txt) would output
permutation index arrays and fasta enumerated groups at the top of the output list .
The permutation index array appearing on the end of the output list requires inserting in a document calc utility and producing
a four column line chart . (Bellow) Line chart describing permutation groups , red and blue line out of sorted columns A and B , yellow line frequency count .
The permutation index array appearing at the beggining of the output list may be searched for composite index sequences .
Their line numbers would reference corresponding fasta sequences in the line enumerated fasta array .
Although having same index sequence numbers they will reference permutated fasta sequences .
17 CCTGGGGCTC
18 CTGGTCCCAGGT
19 GTTTCTAAGAAG
20 CCATCACTCTCA
21 GTGCAGCCGGGT
Further analysis would require Blast (www.ncbi.nih.gov) searches having these fasta sequences as input .
Above mRNA data was published by the Cancer Program Datasets title at www.broadinstitute.org .
Subsequent computations were motivated by the article (published by www.ncbi.nih.gov) :
On the complexity measures of genetic sequences.
Institute of Mathematics, Siberian Branch of Russian Academy of Science, Novosibirsk, Russia. gusev@math.nsc.ru
MOTIVATION: It is well known that the regulatory regions of genomes are highly repetitive. They are rich in direct, symmetric and complemented repeats, and there is no doubt about the functional significance of these repeats. Among known measures of complexity, the Ziv-Lempel complexity measure reflects most adequately repeats occurring in the text. But this measure does not take into account isomorphic repeats. By isomorphic repeats we mean fragments that are identical (or symmetric)
modulo some permutation of the alphabet letters(.). RESULTS: In this paper, two complexity measures of symbolic sequences are proposed that generalize the Ziv-Lempel complexity measure by taking into account any isomorphic repeats in the text (rather than just direct repeats as in Ziv-Lempel). The first of them, the complexity vector, is designed for small alphabets such as the alphabet of nucleotides. The second is based on a search for the longest isomorphic fragment in the history of sequence synthesis and can be used for alphabets of arbitrary cardinality(..). These measures have been used for recognition of structural regularities in DNA sequences. Some interesting structures related to the regulatory region of the human growth hormone are reported.
(.)marked by this author
Routine sources are included in genetic_sequence_binary_factor_grouping.zip ( at 20.12.2010 ) in the following execution order : genetic_sequence_binary_factor_grouping.txt
These routines use a permuted number index order based on a merit factor attributed number scale .
The merit factor attributed number scale is computed using scan numbers as 4x4bit binary factor indexes in an 16bit integer array .
The exponents of array sub group counts and corresponding factor sums in relation to actual number serie factor bounds produce the merit factor number attributes .
All computed data and corresponding sequences depend on multiplier values .
Multiplier values determine and abstract ranges and contents of the permutation groups .
(!) mar79_5.cpp ( 28.06.2011 ) is the practical implementation of compression .
To Borce Dzinleski
These routines were written by Dzinleski Jasenko jasenko@unet.com.mk who is the author of C/C++ based routines for encryption/decryption, large numbers operations, the 123SQL database engine and the simplified mariaBasic interpreter which are undergoing projects . This project is self-financing and any contributions are welcomed .
This site resulted in years long support from Borce and Dusica Dzinleski and is devoted to them and especially to my daughter Maria Dzinleska and the faith from Nada Popstefanova .The author is currently seeking for a developers job and this is his cv.
References(1)
GINN AND COMPANY
A Xerox Company
Waltham Massachussets - Toronto - London
TOPICS IN ALGEBRA
I.N.HERSTEIN
Lemma 2.22 Every permutation is the product of its cycles .
References(2)
THE MERIT FACTOR PROBLEM
PETER BORWEIN, RON FERGUSON, AND JOSHUA KNAUER
Abstract
The merit factor problem is of considerable practical interest
to communications engineers and theoretical interest to number theorists.
For binary sequences, although it is generally believed that the merit factor
is bounded, it still has not been completely established that the number
of even length Barker sequences, each with merit factor N, is bounded.
In this paper, we present an overview of the problem and results of quite
extensive searches we have conducted in lengths up to slightly beyond 200.
The merit factor, F, of the sequence relates energy in the sidelobes to energy in the main lobe, F = N2 / 2E
References(3)
Discrete Applied Mathematics 155 (2007) 831 ? 839
Binary templates for comma-free DNA codes from Oliver D. King , Philippe Gaborit :
Abstract
Arita and Kobayashi proposed a method for constructing comma-free DNA codes using binary templates, and showed that the
separation d of any such binary template of length n satisfies d>=n/2. Kobayashi, Kondo and Arita later produced an infinite family
of binary templates with d>=11n/30. Here we demonstrate the existence of an infinite family of binary templates with d>=n/2 -
(18n loge n)1/2.We also give an explicit construction for an infinite family of binary templates with d>=n/2 - 19n1/2 loge n.
© 2006 Elsevier B.V. All rights reserved.
References(4)
In DNA Sequence Design Using Template © Omsha,Ltd.2002 , By Masanori Arita and Satoshi Kobayashi , published by SpringerLink (15 Febrruary 2002) , and - This paper has been selected to receive the New Generation Computing Award for Distingushed Papers - the authors state :
Abstract
Sequence design is a crucial problem in information-based
biotechnology such as DNA-based computation . We introduce a simple strategy
named template method that sistematically generate a set of sequences
of length l such that any of its member will have approximatively 1/3 mismatches
with other sequences , their complements , and the overlaps of their
concatenations .
References(5)
Proc. of The Fifth Int. Workshop on Frontiers in Evolutionary Algorithms (FEA 2003) under JCIS 2003 Cary, NC, USA, September 26-30, 2003
Reliable Cost Predictions for Finding Optimal Solutions to
LABS Problem: Evolutionary and Alternative Algorithms
Franc Brglez1, Xiao Yu Li1, Matthias F. Stallmann1 and Burkhard Militzer2
1Computer Science Department, NC State University, Raleigh, NC 27695, USA
2Lawrence Livermore National Laboratory, Livermore, CA 94550, USA
ABSTRACT
The low-autocorrelation binary sequence (LABS) problem
represents a major challenge to all search algorithms, with
the evolutionary algorithms claiming the best results so far.
However, the termination criteria for these types of stochastic
algorithms are not well-defined and no claims have been
made about optimality. Our approach to find the optima of
the LABS problem is based on (1) experiments with problem
sizes for which optimal solutions are known, (2) an asymptotic
analysis of statistics generated by such experiments, (3)
reliable predictions of the cost required to find optimal solutions
for larger problem sizes. The proposed methodology
provides a well-defined termination criterion for evolutionary
and alternative search algorithms alike.
Keywords: fundamental combinatorial algorithms, performance
predictions and evaluations, low-autocorrelation binary
sequence, evolutionary algorithms
IMPLEMENTATION- RIFF(WAV) COMPRESSION (principia example)
This is a binary compression implementation on PDA recording device output file (16 bit, 8000 Hz, 128 kbps Wav). This functional example performs looseless wav compression on PDA recording file up to 350 sec.
08.07.2008 VRM 1.0.0 Download File mar70.zip- BYTE ORDER COMPRESSION
mdiff and boc routines byte order compression utilization via (re) occuring 2-byte order pairs indexing . This routine processes each data byte and next data byte pair (s) through this C/C++ code ((((b8e&<data byte>)>>1)^((b8e&<next data byte>)>>1))<<1)|((b8o&<data byte>)^(b8o&<next data byte>)) where b8e is an 8-bit even bit mask and b8o is an 8-bit odd bit mask . Thus 2-byte (s) order (sequence) is truncated into a single byte field . Two byte resultant field (s) consisting of byte 1, byte 2 and byte 2, byte 3 for a single 16-bit dictionary entry . Thus compressed data results in ( (re) occuring entries) index number order . Index entries are bit truncated when written to the compressed data output file . Compression dictionary produced while compressing typical ASCII data file eg source code or HTML code is relatively small and average compression gains in such files are good .
12.09.2008 VRM 1.1.0 Download File e1173.zip
- 6-bit BINARY COMPRESSION
This is a fast compression routine based on a 4-byte data word translation via 6-bit bit parity table . 6 bit table entries were computed by ommitting last two bits (having decimal values 1 and 2) in a single byte (0 to 255) giving 64 index entries combination (s) per data byte . Also all truncation entries from a 4-byte data word have only 256 combination (s) . The 4 6-bit (truncated) dictionary entries are (re) indexed and writen to a compressed data output file in a truncated index number order having (binary) length (s) from 7 to 18 bits compared to the original data 32 bit (word) length . Useful for compressing large document data files (binary and text data documents) . Yet compression gain in ASCII data files is obvious due to short binary length of index number entries .
30.03.2010 VRM 3.5.1 Download File mar6_351_1.zip
- BINARY COMPRESSION 79
This a binary compression based on 2-byte data word right (low) bit truncation dependent on max of dictionary (re) occurences for each data buffer . Thus such (truncated) dictionary entries represent most of input data buffer . Dictionary entries are written to the compressed data file in a left truncating manner with the leftmost significant bit ommited , having 7 to 16 bits in length . This method performs fast and efficient data storage . This routine performs principia used in the bellow listed methods .
14.08.2010 VRM 3.1.3 Download File mar79_313_1.zip
18.08.2010 VRM 4.0.1 Download File mar79_401_1.zip
20.08.2010 VRM 4.1.1 Download File mar79_411_1.zip
06.02.2011 VRM 5.0.1 Download File mar79_501_2.zip
16.02.2011 VRM 5.1.0 Download File mar79_510_2.zip
12.06.2011 VRM 5.3.0 Download File mar79_530_1.zip
29.06.2011 VRM 5.3.1 Download File mar79_531_1.zip
15.06.2011 VRM 5.4.0 Download File mar79_540_1.zip
25.06.2011 VRM 5.4.1 Download File mar79_541_1.zip
15.07.2011 VRM 5.4.3 Download File mar79_543_1.zip
15.07.2011 VRM 5.3.3 Download File mar79_533_1.zip
mls_13 is a file packager usefull in conjunction with mar79_510_1
To create a filesystems subtree archive : mls_13 -c (source) drive:\path...\
To restore an mls_A11.mar archive : mls_13 -r (target) drive:\path...\
29.11.2011 VRM 1.4.0 Download File mls_14.zip
- BINARY TEXT COMPRESSION
This is a fast and efficient compression example that executes fast input data indexing and dictionary occurrence search based on binary 4x4-bit long data samples . Indexed sequences are checked vs variable data length buffer .
Thus this compression method gains speed concerning strict 4x4(16) - bit long dictionary patterns . This routine is subject of further development .
04.09.2007 VRM 1.3.3 Download File mar9.zip
- BINARY COMPRESSION ROUTINE
Binary compression methods are widely used in communications, data storage and numeric analysis. Exploring genetic complexity numeric sequences employ such methods. Some of them are presented on this site together with a command-line Win32 implementation (s) that demonstrates the capability of compression of large ASCII data files and binary files and also slightly modified in numeric data sequence analysis. This binary compression method is based on numeric sequence generated by the following binary formula as presented by the C/C++ syntax: #define op_7(x,y)(((x+y)^y)|(((x&y)!=0)?(x&y)/y:0)) . This numeric sequence represents all numbers from 0-255(8-bit) for 0-127(7-bit) arguments in an x-y matrix manner . When always x=y and x:0-127 it results in all 8-bit odd numbers . When applied on a 2-byte data sequence it results in 14 or less bits long index . Combined together with one 1-bit substract indicator it will allow compression . Using these arguments as dictionary entries coded by hi/lo/length indicators whose reocurring indexes are stored instead of the input data allows gain of an average 30% compression in large ASCII text files . This numeric sequence formula was generated by another routine written for the purpose of exploring numeric sequences generation .This is an compression Win32 command-line tool based on binary compression . This example states the speed and efficiency of this static large ASCII files compression method .
04.09.2007 VRM 1.3.3 Download File mar.zip
- BINARY COMPRESSION 77
This is a binary compression based on 2-byte long data binary shifting concatenation (bit density increase) into dictionary entries that are left truncated (common in ASCII data text files) . Compression gain depends on data redundancy in an inverse meaning . The larger the enthropy compression will increase .
04.06.2008 VRM 1.1.0 Download File mar77.zip
- BINARY FACTOR GROUPING COMPRESSION ROUTINE
This compression example uses binary pattern indexing by 2-byte sequence bit truncation from 16-12 bits in order to gain max of dictionary occurrence . This compression method is a compression gain vs unoptimized compression speed compromise .
This example states the correctness of the genetic text complexity display routine since its dictionary covers most of the numeric sequences occurrence . Yet this compression example is subject of further development .21.09.2007 VRM 1.4.0 Download File mar73.zip
- ASCII TEXT FILE FAST SORT/INDEXING Routine
This is a fast sorting/indexing example that builds a file position sorting tree as a result of n-depth text file line byte sorting . The sorted sequence tree may expand to further depth levels , this routine uses default depth 6. It exibits fast sorting of a text file up to the size 100K lines/rows .
E.g.: C:\msort3 -f "War and Peace NT.txt"
30.10.2007 VRM 1.3.1 Download File msort3.zip
- MCALC Simple Calc routine
This is a simple CALC screen routine .
The -d2 or -d4 or -d6 command line switch stands for number of decimal places . Keyboard input exit char is q and reset char is c .
09.10.2009 VRM 1.0.1 Download File mcalc.zip
- MDUMP ASCII Text File Sequence Redundance Dump
This is a ASCII text file dump method that finds text data sequences inside a ASCII text file . Usefull for creating text file data sentence definition (s) .
18.09.2009 VRM 2.0.1 Download File mdump3.zip
- MDADD STRING DATE ADD
This is a string date add routine that computes add of start date with increment in days, months and (or) years . Comand line switches requires the start date string, increment string input together with a date formating string eg mdadd 20081008 00010000 YYYYMMDD (for adding 1 year) .
16.11.2008 VRM 1.1.1 Download File mdadd.zip
- MDDIFF STRING DATE DIFFERENCE
This is a string date difference routine that computes difference between two date strings in days, months and years . Comand line switches require two date (s) string input together with a date formating string eg mddiff 19591117 20081008 YYYYMMDD .
08.10.2008 VRM 1.1.0 Download File mddiff.zip
- MDIFF FILE COMPARE
This is a file compare routine based on a bit parity comparisson of 2-byte sequences . Hashing was built on sequenced use of this C/C++ code ((((b8e&<data byte>)>>1)^((b8e&<next data byte>)>>1))<<1)|((b8o&<data byte>)^(b8o&<next data byte>)) where b8e is an 8-bit even bit mask and b8o is an 8-bit odd bit mask , examined via byte sequence group (s) count (file 1 vs file 2) compare . Command line requires file 1 name and file 2 name resulting in fast comparrison result message . The -d (detail) switch displays all difference (lines) . Useful for file compare and change tracking in document and source code files .
26.05.2010 VRM 3.0.1 Download File mdiff_301_1.zip
- BIT PARITY BYTE ORDER FILE CHECKSUM
This is a file fingerprint routine that outputs cheksum number (s) file . Hashing was built on sequenced use of this C/C++ code ((((b8e&<data byte>)>>1)^((b8e&<next data byte>)>>1))<<1)|((b8o&<data byte>)^(b8o&<next data byte>)) where b8e is an 8-bit even bit mask and b8o is an 8-bit odd bit mask . Sequenced number treshold count was computed with comarisson of original byte (bit parity) result vs generated result . Number point (s) were computed inside a 1024 byte file buffer and stored (XOR op) inside a 512 number sequence consequently . The output fingerprint file numbers state data order and integrity eg when compared vs same file (copy from restore or data transfer) cheksum (s). Command line requires input filename and cheksum output filename . Usefull for building cheksum list (s) of important data archive (s) .
25.03.2009 VRM 1.3.0 Download File bp_boc3.zip
Bit parity tools at Brothersoft
http://www.brothersoft.com/bit-parity-tools-169821.html
16.07.2011 VRM 5.0.3 Download msearch_141 , mdiff_301 , boc , mar79_543_1 and mls_13 in bp_tools_503_1.zip
THE RANDOM KEYS DISTRIBUTION ENCRYPTION ROUTINE
This is a strong encryption method based on a 4 number keys random number distribution . The 4 (5 - digit) number keys provide strong encryption protection due to message hashing that is provided on random number (s) generation where the inputed keys are used as random seeds . Each user choosen key is randomized and message hash is produced with a different randomizing method . Execution requires usage of the following command line switches:
eg r71 -a 11111 -b 22222 -c 33333 -d 44444 -e < filename to encrypt>
and to decrypt eg r71 -a 11111 -b 22222 -c 33333 -d 44444 -f < filename to decrypt>
where the numbers following the -a -b -c and -d switches are user chosen encryption 5 digit number keys.
1.1(min)...
minmv=999;
for(l=0;l<rsi;++l)
{if(n=0||l==0){n=rs[l][1];continue;}
if(n==rs[l][1]||n+1==rs[l][1]||n-1==rs[l][1]){n=rs[l][1];}else{
if(minmv>rs[l][2]){minmv=rs[l][2];minl=l;}
n=0;}
}
if(df){printf(" %d",rs[minl][0]%outm);}
htable[hti_dmin][0]=rs[minl][0]%outm;++hti_dmin;
...1.2(max)...
maxmv=0;
for(l=0;l<rsi;++l)
{if(n=0||l==0){n=rs[l][1];continue;}
if(n==rs[l][1]||n+1==rs[l][1]||n-1==rs[l][1]){n=rs[l][1];}else{
if(maxmv<rs[l][2]){maxmv=rs[l][2];maxl=l;}
n=0;}
}
if(df){printf(" %d",rs[maxl][0]%outm);}
htable[hti_dmax][1]=rs[maxl][0]%outm;++hti_dmax;
...2.1(min)...
minmv=999;
for(l=0;l<rsi;++l)
{if(n=0||l==0){n=rs[l][1];continue;}
if(n==rs[l][1]||n+1==rs[l][1]||n-1==rs[l][1])
{
n=rs[l][1];
if(minmv>rs[l][2]){minmv=rs[l][2];minl=l;}}else{n=0;}
}
if(df){printf(" %d",rs[minl][0]%outm);}
htable[hti_rmin][3]=rs[minl][0]%outm;++hti_rmin;
...2.2(max)...
maxmv=0;
for(l=0;l<rsi;++l)
{if(n=0||l==0){n=rs[l][1];continue;}
if(n==rs[l][1]||n+1==rs[l][1]||n-1==rs[l][1])
{
n=rs[l][1];
if(maxmv<rs[l][2]){maxmv=rs[l][2];maxl=l;}}else{n=0;}
}
if(df){printf(" %d",rs[maxl][0]%outm);}
htable[hti_rmax][3]=rs[maxl][0]%outm;++hti_rmax;
...(1) Each of the entered key numbers resultant distribution series (3-133)*(3-7) according to these criteria are written in a 4 column table
(2) Each table is hashed according the bellow listed binary criteria
(3) The 4 resulting tables are then re-hashed using the same binary criteria.#define op_A(w,x,y,z)(((((w&0x0000ffff)<<16)|x)&0xffff0000)|((((y&0x0000ffff)<<16)|z)&0x0000ffff))
#define op_B(w,x,y,z)(((((x&0x0000ffff)<<16)|w)&0xffff0000)|((((z&0x0000ffff)<<16)|y)&0x0000ffff))
#define op_E(w,x,y,z)(op_A(w,x,y,z)>op_B(w,x,y,z)?op_A(w,x,y,z):op_B(w,x,y,z))
One out of the 4 functions running inside this encryption was used in the Game of life using 100x100 cells that outputs the generations data in a graphics BMP file format .
Download a game of life VRM 1.3.1 at 17.07.2007 and it states the diversity of random number distributions produced .
Try looping this encryption in the following way:
Step 1.C:\r7 -a <key1 number> -b <key2 number> -c <key3 number> -d <key4 number> -e "filename.txt"
Step 2.C:\r7 -a <key5 number> -b <key6 number> -c <key7 number> -d <key8 number> -e "previous_output.mar"
...
...
Step n.
and repeat it in the same manner n times until the desired security level is gained .18.12.2007 VRM 1.3.3 Download File r7.zip
MARIAHASH THE ENCRYPTION ROUTINE
This is a fast encryption routine using proprietary hashing method. Cypher strength depends on a large hashing number and password length . password text must be entered in a password.txt file and should have between 50 and 100 char(s) .This routine was written by the authors wish to try to improve message privacy while sent across the networks .
09.06.2007 VRM 1.3.0 Download File 79923.zip
THE 123SQL DATABASE ENGINE
This is an undergoing project aimed to construct a small portable SQL database engine for PDA's, and this is a functional browsing engine that contains data and sample browsing statements . Data may be imported together with table/column creation . Typically the source data may be spreadsheet column TAB delimited export data . Database/table/column creation may be viewed in the included code following the -c switch . Table names and column names and field byte sizes should be specified, but column/field lengths my also vary in size row by row . The engine performs SQL keyword/syntax checking using the syntax/keywords list files included . Object names check and object attributes read is performed in the system database files named 123SQL_db_1.mar and 123SQL_db_2.mar . Database structure allows multiple object browsing . The sorting/searching routines require low machine resources thus meeting most modern PDA specifications and their sources were also published under different names .
This project was founded on the authors' unique relational database engine structure design . The 123SQL engine requires the following command line syntax:
E.g.: C:\910791 -d "Sample"
for attaching and browsing the included database, where Sample is the database name included . When
E.g.: C:\910791 -c "import_data_file.txt"
the engine will create a database table and table columns as specified in the included create.txt syntax and import the data from the file name specified after the -c switch . Number of column definitions and TAB delimited fields must match, if specified column length is greater than data length space justification will occur . Supported SQL like data browsing syntax is :
{select}
{*|column_name|column_name_1,...column_name_n}
{from}
{table_name|table_name_1,...table_name_n}
[where
|[column_name=string_litteral|column_name>string_litteral|column_name<string_litteral]
|[column_name>string_litteral and column_name<string_litteral]
|[column_name[>|<]string_litteral and column_name=string_litteral]
|[column_name=string_litteral or column_name=string_litteral or column_name=string_litteral]
|[column_name>string_litteral and column_name<string_litteral and column_name=string_litteral]
]
123SQL 15.04.2008 VRM 1.5.0 Download file 123SQL.zip
The MariaBasic Interpreter
The Maria Basic Interpreter is a command-line programming tool - interpreter aimed to help PDA users code formula/calculations, string and file procedures that execute on their handhelds. The included source code may easily (re) compile for various OS/CPU architectures , since it was written in ISO/ANSI C and requres moderate machine resources . Interpreter design allows fast execution of basic syntax like procedures with calculations and file/string operations. Its simplified syntax allows basic programming skills and may be used for learning , but may expand to execution of rather complex routines . This interpreter allows basic like (simplified) syntax commands like nesting, statement loops, and conditional execution. The ZIP archive ready for download includes a few txt files which are sample basic syntax supported nesting and file/string function example (s) . Source procedures may execute with a command line stating:
E.g.: C:\mariaBasic -e "mb_305_sorting_1.txt".
The mb_305_arraylikecount_1.txt and mb_305_sorting_1.txt and dec2bin.txt example sources show the code structure necessary to supply for program execution .Supported routine code syntax is :MariaBASIC 3.1.0.5 Coding Structure:
1. Coding convention (s)
1.1.Declarations:
<varname> is a <string literal> + <type declaration> = <initial value>
where
<string litteral> = {[_]|[a-z]|[A-Z]|[0-9]}
<type declaration> = {[%]|[&]|[#]|[$]}
where % stands for integer data type
where & stands for long integer data type
where # stands for double data type
where $ stands for char data type with <=256 bytes
<initial value> =
{
[<string constant> is a single quoted literal having [a-z]|[A-Z]|[0-9]]
|
[<num constant> is a number literal having [0-9]|[.]]
}
logical expression operators are [and]|[or]|[xor]
conditional expression operators are [>]|[<]|[=]|[>=]|[<=]|[<>]
1.2.Program body: Declaration(s) | Statement(s) | Logical expression(s) | Simple Block Statement(s) | Nested Statement(s) | End statement
1.2.1.Statement:
varname[%|&|#]=[[varname[%|&|#]|[<num constant>]][^,*,/,+,-][[varname[%|&|#]|[<num constant>]]
varname$=varname$+varname$
varname[%|&]=len$(varname$)
varname[%|&|#]=val$(varname$)
varname$=trim$(varname$)
varname$=left$(varname$,<num constant>)
varname$=right$( varname$,<num constant>)
varname$=mid$( varname$,<num constant>,<num constant>)
varname$=format$(varname+{[%|&|#]},<string constant>)
varname[%|&|#]=round$(varname#)
open varname$ for [input]|[output] as #<num constant>
input #<num constant>, varname$
print #<num constant>, [<string constant>| varname[%|&|#|$][,]][;]
close #<num constant>
print [<string constant>| varname[%|&|#|$][,]][;]
1.2.2.Logical expression:
varname[%|&]=(varname[%|&|#|$][=,<>,>,<,>=,<=]varname[%|&|#|$]
[and]|[or]|[xor]
[ varname[%|&|#|$][=,<>,>,<,>=,<=]varname[%|&|#|$])
1.2.3.Simple Block Statement:
{if (<conditional expression>) then}
<statement(s)>
{end if}
{while (<conditional expression>)}
<statement(s)>
{wend}
{for varname[%|&]=[[<num constant>]| varname[%|&]] to [<num constant>| varname[%|&]]}
<statement(s)>
{next varname[%|&]}
1.2.4.Nested Statement:
{if (<conditional expression>) then}
<statement(s)>
<simple block statement(s)>
{end if}
{while (<conditional expression>)}
<statement(s)>
<simple block statement(s)>
{wend}
{for varname[%|&]=[[<num constant>]| varname[%|&]] to [<num constant>| varname[%|&]]}
<statement(s)>
<simple block statement(s)>
{next varname[%|&]}
1.2.5.Comment(s):
rem <string constant>
1.3. End Statement:
{end}
MariaBasic at Brothersoft.com
MariaBasic at Downloadtyphoon.com
MariaBasic at Windows7Download.com
MariaBasic, when (re)compiled on PDA's native compiler enables a simple but efficient programming PDA tool.
MariaBASIC for Pocket PC V3.0 (XScale ARM) 14.05.2012 VRM 3.3.0.5 Download file mariaBasic3305_ARM.zip
MariaBASIC 14.05.2012 VRM 3.3.0.5 Download file mariaBasic3305.zip
MariaBASIC (samples) 14.05.2012 VRM 3.3.0.5 Download file mariaBasic3305_samples.zip
rem
rem MariaBASIC
rem DayofWeek Function
rem 3.1.0.7
rem
rem ---------------------
rem start day of year 2011 , Saturday (day 6)
Sd%=5
rem ---------------------
Sdate$='26.04.2011'
Sm002$='0000000000000000000000000000000 '
Sm012$='0000000000000000000000000000000 '
Sml01%=31
Sm022$='0000000000000000000000000000000 '
Sml02%=28
Sm032$='0000000000000000000000000000000 '
Sml03%=31
Sm042$='0000000000000000000000000000000 '
Sml04%=30
Sm052$='0000000000000000000000000000000 '
Sml05%=31
Sm062$='0000000000000000000000000000000 '
Sml06%=30
Sm072$='0000000000000000000000000000000 '
Sml07%=31
Sm082$='0000000000000000000000000000000 '
Sml08%=31
Sm092$='0000000000000000000000000000000 '
Sml09%=30
Sm102$='0000000000000000000000000000000 '
Sml10%=31
Sm112$='0000000000000000000000000000000 '
Sml11%=30
Sm122$='0000000000000000000000000000000 '
Sml12%=31
St0$=''
St1$=''
St2$=''
St3$=''
St5$=' '
V1%=0
V2%=0
V3%=0
Vl%=0
Vm%=1
while (Vm%<=12)
rem ---------------------
if (Vm%=1) then
Vl%=Sml01%+0
rem print 'January'
end if
if (Vm%=2) then
Vl%=Sml02%+0
rem print 'February'
end if
if (Vm%=3) then
Vl%=Sml03%+0
rem print 'March'
end if
if (Vm%=4) then
Vl%=Sml04%+0
rem print 'April'
end if
if (Vm%=5) then
Vl%=Sml05%+0
rem print 'May'
end if
if (Vm%=6) then
Vl%=Sml06%+0
rem print 'June'
end if
if (Vm%=7) then
Vl%=Sml07%+0
rem print 'July'
end if
if (Vm%=8) then
Vl%=Sml08%+0
rem print 'August'
end if
if (Vm%=9) then
Vl%=Sml09%+0
rem print 'September'
end if
if (Vm%=10) then
Vl%=Sml10%+0
rem print 'October'
end if
if (Vm%=11) then
Vl%=Sml11%+0
rem print 'November'
end if
if (Vm%=12) then
Vl%=Sml12%+0
rem print 'December'
end if
rem ---------------------
rem print Vl%
for V1%=1 to Vl%
Sd%=Sd%+1
St1$=format$(Sd%,'0')
V3%=Vl%-1
St2$=mid$(Sm002$,2,V3%)
if (V1%>1) then
V2%=V1%-1
St1$=mid$(Sm002$,1,V2%)
St3$=format$(Sd%,'0')
St1$=St1$+St3$
V2%=V1%+1
V3%=Vl%-V2%
rem print V2%,' ',V3%
St2$=mid$(Sm002$,V2%,V3%)
end if
St1$=St1$+St2$
Sm002$=''
Sm002$=Sm002$+St1$+St5$
rem print Sm002$
if (Sd%=7) then
Sd%=0
end if
next V1%
rem ---------------------
if (Vm%=1) then
Sm012$=''
Sm012$=Sm012$+Sm002$
Sm002$=''
Sm002$=Sm002$+Sm022$
end if
if (Vm%=2) then
Sm022$=''
Sm022$=Sm022$+Sm002$
Sm002$=''
Sm002$=Sm002$+Sm032$
end if
if (Vm%=3) then
Sm032$=''
Sm032$=Sm032$+Sm002$
Sm002$=''
Sm002$=Sm002$+Sm042$
end if
if (Vm%=4) then
Sm042$=''
Sm042$=Sm042$+Sm002$
Sm002$=''
Sm002$=Sm002$+Sm052$
end if
if (Vm%=5) then
Sm052$=''
Sm052$=Sm052$+Sm002$
Sm002$=''
Sm002$=Sm002$+Sm062$
end if
if (Vm%=6) then
Sm062$=''
Sm062$=Sm062$+Sm002$
Sm002$=''
Sm002$=Sm002$+Sm072$
end if
if (Vm%=7) then
Sm072$=''
Sm072$=Sm072$+Sm002$
Sm002$=''
Sm002$=Sm002$+Sm082$
end if
if (Vm%=8) then
Sm082$=''
Sm082$=Sm082$+Sm002$
Sm002$=''
Sm002$=Sm002$+Sm092$
end if
if (Vm%=9) then
Sm092$=''
Sm092$=Sm092$+Sm002$
Sm002$=''
Sm002$=Sm002$+Sm102$
end if
if (Vm%=10) then
Sm102$=''
Sm102$=Sm102$+Sm002$
Sm002$=''
Sm002$=Sm002$+Sm112$
end if
if (Vm%=11) then
Sm112$=''
Sm112$=Sm112$+Sm002$
Sm002$=''
Sm002$=Sm002$+Sm122$
end if
if (Vm%=12) then
Sm122$=''
Sm122$=Sm122$+Sm002$
Sm002$=''
end if
rem ---------------------
Vm%=Vm%+1
wend
rem ---------------------
Sdd$=''
Sdd$=mid$(Sdate$,1,2)
Smm$=''
Smm$=mid$(Sdate$,4,2)
V1%=val$(Smm$)
V2%=val$(Sdd$)
rem ---------------------
if (V1%=1) then
Sm002$=''
Sm002$=Sm002$+Sm012$
end if
if (V1%=2) then
Sm002$=''
Sm002$=Sm002$+Sm022$
end if
if (V1%=3) then
Sm002$=''
Sm002$=Sm002$+Sm032$
end if
if (V1%=4) then
Sm002$=''
Sm002$=Sm002$+Sm042$
end if
if (V1%=5) then
Sm002$=''
Sm002$=Sm002$+Sm052$
end if
if (V1%=6) then
Sm002$=''
Sm002$=Sm002$+Sm062$
end if
if (V1%=7) then
Sm002$=''
Sm002$=Sm002$+Sm072$
end if
if (V1%=8) then
Sm002$=''
Sm002$=Sm002$+Sm082$
end if
if (V1%=9) then
Sm002$=''
Sm002$=Sm002$+Sm092$
end if
if (V1%=10) then
Sm002$=''
Sm002$=Sm002$+Sm102$
end if
if (V1%=11) then
Sm002$=''
Sm002$=Sm002$+Sm112$
end if
if (V1%=12) then
Sm002$=''
Sm002$=Sm002$+Sm122$
end if
rem ---------------------
St$=''
St$=mid$(Sm002$,V2%,1)
V1%=val$(St$)
rem ---------------------
if (V1%=1) then
print Sdate$,' ','Monday
' end if
if (V1%=2) then
print Sdate$,' ','Tuesday'
end if
if (V1%=3) then
print Sdate$,' ','Wednesday'
end if
if (V1%=4) then
print Sdate$,' ','Thursday'
end if
if (V1%=5) then
print Sdate$,' ','Friday'
end if
if (V1%=6) then
print Sdate$,' ','Saturday'
end if
if (V1%=7) then
print Sdate$,' ','Sunday'
end if
rem ---------------------
end
MariaBASIC Number Permutation Cycle Function (ASCII Text Rhymes) output having all 1(s),2(s),...9(s) as input and its C/C++ code (!) num_c_perm.cpp .
rem --------------------
rem MariaBASIC
rem Number Permutation Cycle Function (ASCII Text Rhymes)
rem 3.2.0.3
rem --------------------
Vars1$='1234567890 '
Vars2$=''
Vars3$=''
Vars4$=''
Vars5$=''
rem 1. run Vars6$='1111111111 '
rem run 1. resulting file
011120
058139
012370
038036
013938
028263
rem 2. run arg=011+058+012+0
Vars6$='0110580120 '
rem run 2. resulting file
001106
005786
001231
003785
001387
002812
Vars7$=''
Vars8$=''
Vars9$='n.txt'
Vars10$=''
Vari1%=0
Vari2%=10
Vari3%=0
Vari4%=0
Vari5%=0
Vard1#=0
Vard2#=0
Vard3#=0
Vard4#=0
Vard5#=0
Vard6#=0
rem --------------------
for Vari1%=1 to 9
Vari3%=Vari2%-Vari1%
Vars3$=mid$(Vars1$,Vari3%,1)
Vars4$=mid$(Vars1$,Vari1%,1)
Vars2$=Vars2$+Vars3$+Vars4$
next Vari1%
print Vars2$
rem --------------------
open Vars9$ for output as #1
VariL%=9
while (VariL%>3)
Vars5$=''
for Vari1%=1 to VariL%
Vari3%=Vari2%-VariL%
Vars3$=mid$(Vars2$,Vari3%,1)
Vars4$=mid$(Vars2$,Vari1%,1)
Vars5$=Vars5$+Vars3$+Vars4$
next Vari1%
if (Vari5%=1) then
print Vars5$
end if
Vars7$=mid$(Vars5$,1,5)
rem --------------------
Vard5#=val$(Vars7$)
Vard6#=val$(Vars6$)
rem --------------------
if (Vari5%=1) then
print Vard6#,Vard5#
end if
Vard1#=Vard6#/Vard5#
Vars8$=format$(Vard1#,'000000.00')
print Vars8$
Vars10$=mid$(Vars8$,1,3)
print #1,Vars10$;
Vars10$=mid$(Vars8$,4,3)
print #1,Vars10$
VariL%=VariL%-1
wend
end
The Eleven Comedies , an english translation of Aristophanes et al Comedies (from Project Gutenberg eBook)
Part 1 , chart 1 ,
and chart 2 from Part 2 generated by num_c_perm_2.cpp .
War and Peace , an english translation of Tolstoy (from Project Gutenberg eBook) permutation chart generated by num_c_perm_2.cpp .
The Notebooks of Leonardo Da Vinci , an english translation of Leonardo Da Vinci (from Project Gutenberg eBook) permutation chart generated by num_c_perm_2.cpp .
THE FAST (ASCII and Unicode) TEXT FILES SEARCH ROUTINE
This is a fast text search routine that allows single (or quoted composite) string search throughout an ASCII or Unicode text (text containing) file(s) . Unicode search will also allow strings containing mixtures of different Unicode table(s).
E.g.:
1. (ASCII search) msearch3 <ASCII_input_filname.txt> <search_string>
2. (Unicode search) msearch3 <Unicode_input_filname.txt>
(search string in Unicode file uarg.txt and search results in Unicode file ures.txt)
03.07.2008 VRM 1.1.1 Download File msearch3.zip
THE FAST ASCII TEXT FILES SEARCH ROUTINE
This is a fast text search routine that allows multi string (up to 10 search strings containing one or more words within) search throughout an ASCII text file . So, each search string (quoted) may have one or more words. The -s switch allows any match, while the -e switch allows only exact match.
E.g.: C:\msearch -s(-e) "package install"+"media"+"component" -f "FreeBSD Handbook.htm"
E.g.: C:\msearch -s(-e) "network devices installation" -f "FreeBSD Handbook.htm"
E.g.:C:\msearch -s(-e) "trodes in his hands" -f "book_sd.txt"
E.g.:C:\msearch -s(-e) "Bezukhov and Natasha"+"Buonaparte Napoleon"+"Pierre" -f "War_and_Peace_NT.txt"
The program output will display all results along with their line number file positions, the unique and composite sentence search phrase matches together with their total occurrence count.15.04.2008 VRM 1.3.3 Download File msearch.zip
09.04.2010 VRM 1.4.1 Download File msearch_141_1.zip
mSearch4 using modified search routine code - single search long sentence string 25.04.2012 VRM 1.0.3 Download File mSearch4_103.zip
mSearch4_110 Allows 1-10 search strings divided by logical conjunction and inclusion symbols 18.05.2012 VRM 1.1.0 Download File mSearch4_110.zip
Example - single search sentence : mSearch4_110 msearch -s"Mucius Scaevola" -f"War_and_Peace_NT.txt"
Example - search two sentence(s) in conjunction : mSearch4_110 msearch -s"Mucius&Scaevola" -f"War_and_Peace_NT.txt"
Example - search two sentence(s) with inclusion : mSearch4_110 msearch -s"Mucius|Scaevola" -f"War_and_Peace_NT.txt"
THE ASCII TEXT FILES SENTENCE CONTEXT SEARCH ROUTINE
This is a text file complex search routine that allows text search build on the context - sentence words concerning a given subject . This search allows automated search criteria build depending on sentence words contents and user choice . Sentence words files and their sentence links are built during the indexing phase for a given text file . After indexing, the routine will display all sentences for a chosen sentence subject (as enlisted in the words file) and allow detailed context search and all sentences display concerning the chosen context .
For the indexing type:E.g.: C:\dp_13_201_1 -f "War_and_Peace_NT.txt"
For the context search type:E.g.: C:\msearch_141_d_1 -s(e) "Bagration" -f "War_and_Peace_NT.txt"
The -s switch enables any match search when d was chosen, and -e switch enables only exact word match. The included files contain the examples book already indexed. Typically the search word is a name, or a subject that is being often described and attributed in the book text . So after viewing/choosing the desired sentence/search combination all text lines containing the chosen words will be displayed . Thus viewing book contents by desired subject details requires smaller amount of time .15.04.2008 VRM 1.3.0 Download File r113.zip
28.04.2010 VRM 2.0.1 Download File text_file_context_search_201_1.zip
This package contains (1) the dictionary routine and mSearch4_110 routine that allows multile text sentences serches with logical conjunctions and inclusions 18.05.2012 VRM 3.0.0 Download File text_file_context_search_300.zip
THE FONT IMAGE RECOGNITION ROUTINE
This routine creates a vector shape sequence file (using -i switch) out of an 100x100 pixels 24 bit colour depth black and white image representing a character true type image (font) or character freehand drawing . Then using the -c switch the two index files derived from two different images are compared and graphics match result is displayed .
For the indexing type:
E.g.: C:\cr13 -i "Drawing1.bmp" "Drawing1_Index.txt"
For the comparison of two different index files type:
E.g.: C:\cr13 -c "Drawing1_Index.txt" "Drawing2_Index.txt"
At present the routine builds shape vectors on black/white bitmaps, it does not support different resolution nor colors/color depth.
But how does it work?
(1) indexing, creates vector txt file (that might be the meta character file) out of the bmp image file in the following manner:
- inverts the b/w file matrix (the way human eye sees it),
- searches for quadrants (10x10 pixels sized) with 40/60% b/w ratio, thus finding character image edges (up to 8 pairs in the same row),
- creates vectors out of each quadrant,
- shifts quadrants by (only) few pixels UP since bmp edges do not always REALLY represent character ID curves, repeating vector creation ...
and
(2) comparison of two vector files:
- shifts back all X-axis values subtracting them by absolute minX value,
- computes curve angles out of each quadrant values,
- computes resultant angles out of quadrant pairs building most real character curves,
- compares the two vector files angle pairs,
- computes match statistics .
This development is aimed for PDA users using easier ways for text input.
To Maria Dzinleska
27.04.2007 VRM 1.0.1 Download File cr13.zip
THE ROUTINE THAT GENERATES THE PRIME NUMBERS KEY PAIR OUT OF THEIR PRODUCT
These routines were written during and for the www.rsa.com prime key numbers context that requires finding the exact prime numbers key pair out of a very large (256,512...1024... bits long) product number. The routines were written in java and use the BIGINTEGER java class in order to compute the prime key pair .The starting point routine finds a prime numbers key pair with product_number_bit_length/2 bit length that give sufficient accuracy (near as far as possible) to the product number, the more the preciseness the more the computing time to spend . So the loop that computes the suggested starting prime number pair is limited with the corresponding number of equal product-target significant digits . The remaining procedures consequently perform a very long (all 1's and trailing ZEROS) 111 ... *10^N substraction (s) from the suggested key pair measuring the distance (difference) from the target product number by subsequent multiplication checks . At the point of diverging found and at a certain preciseness (number of equal significant digits) a new key pair may be generated through the first routine . Than the process has to be repeated while gaining more and more equal product-target significant digits .
23.07.2006 Download File Welcome.zip
How do these computations compute a very similar or near prime key pair out of a large product key?
Exmining the bellow listed mariBasic code and its (partial) output shows a few number products appearing at large division loop distances and having a 0000 period between decimal remainder values . Testing those (listed) numbers might prove that most of them are prime numbers . Testing large (200 decimal or more) product keys in this way would take indefinite time . So, the WelcomeQ routine uses a substraction operation on a proposed prime key pair . The routine that generates prime key pairs that have a given decimal target product number match is based on a binary field seed number modification basing only on target match numbers as match search loop starting point . The substractor (having the (decimal) value of e.g. 1111111111000000000000000) shifts the 1111111111 period to the right by approoving that this way truncated prime key pair product matches more and more decimals to the target product number . Actually there are sets of prime kepairs obtaining a certain decimal match .Usually it is necessay to switch between different pairs in order to increase the decimal match of the product . And that is the main iteration of this method sometimes requiring examining and rejecting large number of prime key pairs in order to gain one or more decimal match more . Gaining a 100 decimals precisenes on a common PC computer thus would not be hard to achieve . These computations generate prime keys having computable decimal match gain or complete product number match compared to a given huge product number .
Brief order and explanation of execution steps:
rem Short multiply factor pair routine
rem example in MariaBasic 3.2.1.1
rem April , 26 , 2012
Varn$='3539572063110071 '
Varn1$=''
Varn2$=''
Varn3$=''
Varn4$=''
Vard1#=0
Vard2#=0
Vard3#=0
Vard4#=0
Vard5#=0
Vard6#=0
Vari1%=0
Vari2%=0
Vari3%=0
Vari4%=0
Vari5%=1
while (Vari5%<=12)
Vard1#=val$(Varn$)
Varn1$=mid$(Varn$,Vari5%,3)
Vari1%=len$(Varn$)
Vari2%=len$(Varn1$)
Vari3%=Vari1%+1-Vari2%-Vari5%
Vard2#=val$(Varn1$)
Vard2#=Vard2#+0
Vard2#=Vard2#*10^Vari3%
Vard6#=Vard1#/Vard2#
print '--------------------'
Varn2$=format$(Vard1#,'000000000000000')
print Varn2$
Varn2$=format$(Vard2#,'000000000000000')
print Varn2$
Varn2$=format$(Vard6#,'000000000000000')
print Varn2$
print '--------------------'
Vari5%=Vari5%+3
wend
print '--------------------'
print '--------------------'
Vard11#=0
Vard12#=0
Vard13#=0
Vard21#=0
Vard22#=0
Vard23#=0
Vard24#=0
Vard25#=0
Vars11$='9570000000000'
Vars12$='369'
Vard11#=val$(Vars11$)
Vard12#=val$(Vars12$)
Vard13#=Vard13#+Vard11#*Vard12#
Varn2$=format$(Vard13#,'000000000000000')
print Varn2$
Vard21#=val$(Varn2$)
print '--------------------'
print '--------------------'
Vars11$='2060000000'
Vars12$='1718238'
Vard11#=val$(Vars11$)
Vard12#=val$(Vars12$)
Vard13#=Vard13#+Vard11#*Vard12#
Varn2$=format$(Vard13#,'000000000000000')
print Varn2$
Vard22#=val$(Varn2$)
print '--------------------'
print '--------------------'
Vars11$='3110000'
Vars12$='1138126065'
Vard11#=val$(Vars11$)
Vard12#=val$(Vars12$)
Vard13#=Vard13#+Vard11#*Vard12#
Varn2$=format$(Vard13#,'000000000000000')
print Varn2$
Vard23#=val$(Varn2$)
Vard24#=Vard24#+Vard21#+Vard22#/1000+Vard23#/1000000
print '--------------------'
print '--------------------'
Varn2$=format$(Vard24#,'000000000000000')
print Varn2$
Varn2$=format$(Vard1#,'000000000000000')
print Varn2$
Vard25#=Vard1#-Vard24#
print '------difference---'
Varn2$=format$(Vard25#,'000000000000000')
print Varn2$
print '--------------------'Dzinleski Jasenko - jasenko@unet.com.mk
Mailing Address:
+38922770296
Dositej Obradovik 15/8
1000 Skopje Republic of Macedonia
(1) All published data, executables and sources from this site described above apply to GNU General Public License and can be used, copied, sold, redistributed or used in any other way only by written permission of Jasenko Dzinleski . Copyright (C) from 2001 - 2011 and later by Jasenko Dzinleski
(2) This program is free software; you can redistribute it and/or modify it under the terms of the GNU General Public License as published by the Free Software Foundation; either version 2 of the License, or (at your option) any later version , if not opposite to (1) .
(3) This program is distributed in the hope that it will be useful, but WITHOUT ANY WARRANTY; without even the implied warranty of MERCHANTABILITY or FITNESS FOR A PARTICULAR PURPOSE . See the GNU General Public License for more details .
You should have received a copy of the GNU General Public License along with this program; if not, write to the Free Software Foundation, Inc ., 51 Franklin Street, Fifth Floor, Boston, MA 02110-1301, USA .